Class 12 Biology Previous Year Questions, Chapter-wise (2022-2026)

Identify the plant in which emasculation is not required for artificial hybridization.

1. Rice
2. Wheat
3. Pea
4. Papaya

Perisperm present in seed of black pepper is remnant of

1. Ovary
2. Nucellus
3. Anther
4. Megaspore

Assertion (A) : Apomixis leads to production of genetically identical offsprings. Reason (R) : Apomixis involves fertilization between two genetically similar plants.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation for Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not correct explanation for Assertion (A).
3. Assertion (A) is true, Reason (R) is false.
4. Assertion (A) is false, Reason (R) is true.

Assertion (A) : Pollen grains have a mucilaginous covering on them in most of the water pollinating plants. Reason (R) : Mucilaginous covering help pollen grains to be submerged in water.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation for Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not correct explanation for Assertion (A).
3. Assertion (A) is true, Reason (R) is false.
4. Assertion (A) is false, Reason (R) is true.

Self-incompatibility in some flowering plants is a _____ mechanism that prevents self-fertilization.

1. Morphological
2. Physiological
3. Anatomical
4. Genetic

When the wrong type of pollen falls on the stigma of a flower, during the process of pollination, what decision does the pistil take?

1. Accepts the pollen
2. Rejects the pollen
3. Dissolves the pollen
4. Modifies the pollen

Select the correct option for the pair of plants pollinated by water.

1. Vallisneria and Hydrilla
2. Zostera and Water lily
3. Water lily and Parthenium
4. Water hyacinth and Water lily

Which part of the ovule hardens to form seed coat of a seed ?

1. Funicle
2. Chalaza
3. Nucellus
4. Integuments

Assertion (A): Cleistogamous flowers have assured seed set. Reason (R): Cleistogamous flowers are invariably autogamous and do not depend on any pollinating agents.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Filiform apparatus in the embryo sac of an angiosperm is present at the micropylar tip of:

1. Central cell
2. Egg cell
3. Synergids
4. Antipodals

The cells of endosperm have 24 chromosomes. What will be the number of chromosomes in the gametes?

1. 8
2. 16
3. 23
4. 32

Select the statements that are true for a typical dicotyledonous embryo from the given options. (i) It consists of an embryonal axis and scutellum. (ii) The portion of embryonal axis above the level of cotyledon is epicotyl. (iii) The portion of embryonal axis below the level of cotyledon is coleorhiza. (iv) The lower end of the embryo has radicle covered with a root cap. Choose the correct answer:

1. (i) and (ii)
2. (i) and (iii)
3. (iii) and (iv)
4. (ii) and (iv)

Select the statements that are true for a typical megasporangium of flowering plants. (i) It is attached to the placenta by hilum. (ii) It has a chalaza end that represents the basal part of the ovule. (iii) It has nucellus enclosed by integuments. (iv) Its micropylar end is known as chalaza. Choose the correct answer:

1. (i) and (ii)
2. (ii) and (iii)
3. (iii) and (iv)
4. (i) and (iv)

Select the statements that are true for outbreeding devices in the flowering plants. (i) They discourage cross-pollination and ensure self-pollination. (ii) They are advantageous as they lead to inbreeding depression. (iii) Self-incompatibility prevents self-pollen from fertilising the ovules. (iv) To prevent self-pollination in some species pollen release and stigma receptivity are not synchronised. Choose the correct answer:

1. (i) and (ii)
2. (ii) and (iii)
3. (iii) and (iv)
4. (i) and (iv)

Select the statements that are true for pollination mechanism in flowering plants from the given options. (i) In Vallisneria, the female flowers are pollinated by pollen grains inside the water. (ii) In Zostera, pollen grains are released on the surface of water. (iii) In most of the water-pollinated species, pollen grains are covered by a mucilaginous coating. (iv) Pollination by water is quite rare and limited to about 30 genera. Choose the correct answer:

1. (i) and (ii)
2. (ii) and (iii)
3. (iii) and (iv)
4. (i) and (iv)

Unisexuality of flowers prevents which process ?

1. Both Geitonogamy and Xenogamy
2. Geitonogamy, but not Xenogamy
3. Autogamy and Geitonogamy
4. Autogamy, but not Geitonogamy

Select the following statements that are true for insect pollinated flowers from the given options. (i) Majority of these flowers are large, colourful and rich in nectar. (ii) Nectars and seeds are usual floral rewards to attract insects for pollination. (iii) Pollen grains of these flowers are generally mucilaginous so as to stick to the body of the insects. (iv) A foul odour is emitted by some flowers to attract flies and beetles. Choose the correct answer :

1. (i) and (ii)
2. (ii) and (iii)
3. (iii) and (iv)
4. (i) and (iv)

Select the statements that are true for the seed of angiosperm from the given options : (i) Non-albuminous seeds have no residual endosperm. (ii) Residual, persistent nucellus in wheat is known as perisperm. (iii) Integuments of ovules harden as tough protective seed coat. (iv) Metabolic activity of the embryo slows down in dormancy. Choose the correct option :

1. (i) and (ii)
2. (ii) and (iii)
3. (iii) and (iv)
4. (i) and (iv)

Select the statements that are true for embryo of the flowering plants from the given options. (i) The zygote forms a proembryo and subsequently heart-shaped, globular and mature embryo. (ii) Most zygotes divide to form embryo only after a certain amount of endosperm is formed. (iii) The embryo develops at the micropylar end of the embryo sac. (iv) A typical dicotyledonous embryo consists of an embryonal axis and a scutellum. Choose the correct option from the following :

1. (i) and (ii)
2. (ii) and (iii)
3. (iii) and (iv)
4. (i) and (iv)

Assertion (A) : In some species of asteraceae and grasses, seeds are formed without fertilization. Reason (R) : Formation of fruit without fertilization is called parthenocarpy.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Select the statements that are true for a typical monocotyledonous embryo from the given options. (i) Scutellum is present towards the centre of the embryonal axis. (ii) Embryonal axis of the lower end has radicle and root cap covered by coleoptile. (iii) The portion of embryonal axis above the level of attachment of scutellum is epicotyl. (iv) Shoot apex and few leaf primordia of embryo are enclosed in a hollow foliar structure. Choose the correct answer from the following :

1. (i) and (ii)
2. (ii) and (iii)
3. (iii) and (iv)
4. (i) and (iv)

Choose the option that correctly describes the gynoecium of Michelia:

1. Multicarpellary, Apocarpous
2. Bicarpellary, Apocarpous
3. Multicarpellary, Syncarpous
4. Bicarpellary, Syncarpous

A phenomenon where a male insect mistakenly identified the patterns of a orchid flower as the female insect partner, and tries to copulate and thereby pollinates the flower is said to be:

1. Pseudocopulation
2. Pseudopollination
3. Pseudoparthenocarpy
4. Pseudofertilisation

In which of the following plants are both male and female flowers born on the same plant and the mode of pollination can be geitonogamy or xenogamy ?

1. Papaya
2. Date Palm
3. Maize
4. Spinach

An angiosperm embryo sac is located within the :

1. Placenta
2. Megasporangium
3. Nucellus
4. Ovary

The functional megaspore of an angiosperm develops into:

1. Embryo sac
2. Endosperm
3. Embryo
4. Ovule

The part of the ovule that develops into protective coats of a seed after fertilization in a typical flowering plant is :

1. embryo sac
2. nucellus
3. integuments
4. megaspore

In which one of the following floral plants are many embryos formed in the seeds without fertilisation of the egg cell ?

1. Black pepper
2. Mustard
3. Groundnut
4. Citrus

The ploidy of the apomictic embryos developing from the integument cells and synergids respectively would be :

1. n, 2n
2. 2n, n
3. 3n, 2n
4. 2n, 3n

The mechanism to produce seeds without fertilisation has evolved in the given family of the flowering plants :

1. Asteraceae
2. Solanaceae
3. Malvaceae
4. Liliaceae

Assertion (A) : The zygote gives rise to heart-shaped embryo and subsequently proembryo in most angiosperms. Reason (R) : The zygote is present at the micropylar end of the embryo sac and develops into an embryo.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Embryo formation without fertilization is observed in some species of :

1. Maize
2. Rose
3. Mango
4. Rice

The ploidy of apomictic embryos developing from the nucellus and antipodal cells respectively would be :

1. 2n, 3n
2. 2n, n
3. 3n, 2n
4. n, 2n

In a fertilized ovule of an angiosperm, the cells in which n, 2n and 3n conditions respectively occur are :

1. antipodal, zygote and endosperm
2. zygote, nucellus and endosperm
3. endosperm, nucellus and zygote
4. antipodals, synergids and integuments

Choose the option that gives the correct number of pollen grains that will be formed after 325 microspore mother cells undergo microsporogenesis.

1. 325
2. 650
3. 1300
4. 975

Assertion (A): Endosperm is completely consumed during the development of embryo in ex-albuminous seeds. Reason (R): Castor, pea and beans are all examples of ex-albuminous seeds.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Which of the following seeds have remained alive for the longest period?

1. Phoenix dactylifera
2. Striga asiatica
3. Mangifera indica
4. Yucca gigantea

Assertion (A): The Mediterranean orchid Ophrys uses sexual deceit to get pollinated by a species of bee. Reason (R): The female bee changes its colour depending on the temperature of the area.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Match the correct Structures given in Column I with the Fruit in Column II in the chart given below: Column I (Structure) Column II (Fruit) P. Perisperm i. Maize Q. Thalamus ii. Black pepper R. Pericarp iii. Strawberry S. Endosperm iv. Mango

1. P-i, Q-ii, R-iii, S-ii
2. P-ii, Q-iii, R-iv, S-i
3. P-iii, Q-i, R-i, S-iii
4. P-iv, Q-i, R-ii, S-iv

Which of the following structures is well-developed in a mature seed of black pepper?

1. Perisperm
2. Thalamus
3. Sepals
4. Peduncle

(a) (i) How does a farmer use dormancy of seed to his advantage? (1 mark) (ii) Differentiate between pea seed and castor seed. (1 mark)

How does a farmer use dormancy of seed to his advantage? Differentiate between pea seed and castor seed.

Write any two advantages of producing plants by micro-propagation.

(a) Write one way by which apomictic seeds can be developed. (b) Why do farmers prefer apomictic seeds over hybrid seeds?

(a) Mention the functions of each of the following: (i) Tassels of Corn Cob (ii) Scutellum

Explain the mutually rewarding relationship between Yucca plant and species of moth.

How is the interaction between Ophrys and its specific bee pollinator one of the best examples of co-evolution ? Explain.

"Farmers prefer apomictic seeds to hybrid seeds." Justify giving two reasons.

Do you think apomixis can be compared to asexual reproduction? Justify your answer. State the benefits of apomixis to the farmers.

Identify A, B, C and D in the table given below : Terms | Part of the plant it represents Pericarp | A Cotyledon in seed of grass family | B Embryonal axis | C Remains of nucellus in a seed | D

(b) Name any two outbreeding devices that flowering plants have developed and explain how they help in encouraging cross-pollination.

(a) From which end of the ovule, and how does the pollen tube gain its entry into the embryo sac of a Hibiscus flower? (b) State the fate of the male nuclei present in the pollen tube.

(a) Explain the process of the development of a male gametophyte in an angiosperm. (b) Why is it called a male gametophyte?

(a) Do all pollen grains remain viable for the same length of time? Support your answer with two suitable examples. (2.5 marks) (b) How are pollen grains stored in pollen banks? (0.5 marks)

Draw a neat diagram of megasporangium of an angiosperm and label any six parts. (0.5 × 6 = 3 marks)

(a) Do all pollen grains remain viable for the same length of time? Support your answer with two suitable examples. (2½ marks) (b) How are pollen grains stored in pollen banks? (½ mark)

Do all pollen grains remain viable for the same length of time? Support your answer with two suitable examples. How are pollen grains stored in pollen banks?

Draw a neat diagram of megasporangium of an angiosperm and label any six parts.

There are limitations of traditional breeding techniques that led to promotion of micro-propagation ? (a) Mention two advantages of micropropagation. (b) Give two examples where it is commercially adopted.

Draw a neat diagram of enlarged view of one microsporangium of a Young anther of an angiosperm. Label the different layers of the wall and write the functions of the outermost and innermost layer.

Chasmogamous flowers remain open and expose their reproductive parts. Explain how this structural feature supports different types of pollination.

Answer the following questions: (a) Where do the Coleoptile and Coleorhiza appear in a monocot seed? (b) What is meant by free nuclear endosperm? Give an example. (c) What are parthenocarpic fruits? Give an example.

(a) Explain the different ways by which apomictic seeds can be developed. (b) Mention one advantage of apomictic seeds for farmers.

Draw a neat diagram of a maize grain showing the internal structure and label any five parts.

Answer the following questions : (a) Explain the different ways by which apomictic seeds can be developed. (b) Mention one advantage of apomictic seeds for farmers.

Differentiate between wind-pollinated and insect-pollinated flowers. Give an example of each type.

List any three outbreeding devices that flowering plants have developed for cross-pollination and explain how they help to encourage cross-pollination.

Many of the flowering plants producing hermaphrodite flowers have developed many devices to discourage self-pollination and to encourage cross-pollination. (a) Explain how the given type of pollination is advantageous to the plant. (b) Can this flowering plant show geitonogamy ? Justify your answer.

Flowering plants with hermaphrodite flowers have developed many reproductive strategies to ensure cross-pollination. Study the given outbreeding devices adopted by certain flowering plants and answer the questions that follow. (a) Name and define the outbreeding device described in the above table. (b) Explain what would have been the disadvantage to the plant in the absence of the given strategy.

(a) Mention any two advantages of micropropagation techniques. (b) Write in brief how the process is carried out in the laboratory. (c) Name any two important food plants grown commercially by this method.

If the cells in the leaves of a maize plant contain 10 chromosomes each, write the number of chromosomes in its endosperm and zygote. Name and explain the process by which an endosperm and a zygote are formed in maize.

State why plant breeders are interested in artificial hybridisation programme. How do they carry out this process ?

(a) Explain how it is ensured that the orchid Ophrys is pollinated by a specific species of bee. (b) Describe co-evolution with the help of this example.

Explain how it is ensured that the orchid Ophrys is pollinated by a specific species of bee. Describe co-evolution with the help of this example.

Draw a longitudinal section of pistil of a flower showing growth of the pollen tube. Label the part : (a) through which the pollen tube moves down. (b) the cell wherein the pollen tube releases its contents.

Draw a T.S. of a mature anther of an angiosperm. Label its any three wall layers and mention their functions.

Draw a well labelled diagram of sectional view of male gametophyte/microspore of an angiosperm and write the functions of any two parts labelled. (Any four labels).

(a) (i) Explain the role of stigma in pollen pistil interaction. (ii) Describe the post pollination events leading to double fertilization in angiosperms starting with 2-celled pollen grain.

Explain the role of stigma in pollen pistil interaction. Describe the post pollination events leading to double fertilization in angiosperms starting with 2-celled pollen grain.

(b) (i) Draw a labelled two-celled structure of male gametophyte of an angiosperm. (ii) Name the three layers that surround the cytoplasm of a male gametophyte starting from innermost to outermost layer. (iii) Which organic material makes the outermost layer? Mention its advantage. (iv) Why is the outermost layer of male gametophyte not continuous?

(b)(i) Draw a diagram of L.S. of maize grain and label its any six parts. (ii) Differentiate between perisperm and endosperm giving one example of each.

Explain how does double fertilisation take place in a flowering plant. Write the fate of the products of double fertilization in these plants.

(a) (i) Explain how does double fertilisation take place in a flowering plant. (ii) Write the fate of the products of double fertilization in these plants.

(a) (i) Explain the structure of a typical monocotyledonous embryo of a flowering plant. (ii) How are multiple embryos formed in a citrus fruit? What is the mechanism known as?

(a) (i) Explain the structure of a typical monocotyledonous embryo of a flowering plant. (ii) How are multiple embryos formed in a citrus fruit ? What is the mechanism known as ? OR (b) (i) Name and explain the structural organisation of the male sex accessory ducts in the human male reproductive system. (ii) Describe the role of gonadotropin FSH in the regulation of spermatogenesis.

(a) (i) Explain the structure of a mature embryo sac of a typical flowering plant. (ii) How is triple fusion achieved in these plants ?

(a) lands on the stigma. A two-celled right type pollen has landed on the stigma. Explain the events taking place till fertilization in angiosperms. Why is pollen pistil interaction said to be dynamic?

(a) (i) Explain the development of male gametophyte in an angiosperm. (ii) Draw a labelled diagram of a three-celled male gametophyte. OR (b) (i) Draw a diagrammatic sectional view of ovary of human female and label the following: (1) Blood vessels (2) Primary follicle (3) Tertiary follicle (4) Ovum (ii) At which stage of life are primary follicles formed in a human female ? (iii) Explain the events (both hormonal and structural) that occur at the time of ovulation till the onset of the next menstrual cycle.

(a) (i) Explain the development of male gametophyte in an angiosperm. (ii) Draw a labelled diagram of a three-celled male gametophyte.

(a) (i) Explain the process of double fertilization in an angiosperm starting from the germination of pollen grains on the stigma, mentioning the ploidy of the end products formed at the end. State the role of synergids during the course of the process. (ii) Why does the development of endosperm precede that of the embryo ?

(a) (i) Explain the process of double fertilization in an angiosperm starting from the germination of pollen grains on the stigma, mentioning the ploidy of the end products formed at the end. State the role of synergids during the course of the process.

(a) (i) Explain any four devices that flowering plants have developed to encourage cross-pollination. (ii) Why do plants discourage self-pollination ? State any one reason.

(a) (i) Explain any four devices that flowering plants have developed to encourage cross-pollination. (ii) Why do plants discourage self-pollination ? State any one reason. OR (b) Explain the ovarian and uterine events taking place along with the role of pituitary and ovarian hormones, during menstrual cycle in a normal human female under the following phases: (i) Follicular phase/proliferative phase (ii) Luteal phase/secretory phase (iii) Menstrual phase

(a) (i) State the objective of adopting artificial hybridisation programme in plants. (ii) Describe the steps followed in this technique.

(b) (i) How are the characteristic features of pollen, anther and stigma of a maize plant suited for pollination by wind ? (ii) How do you justify that : (1) Pollen grains are recovered from fossils ? (2) Micropyle remains as a small pore in the seed coat of a fully developed seed ?

(b) You are given a tall pea plant with green seeds. The genotype of this plant is unknown. You are only permitted to carry out self-pollination. Work out all possible crosses and show how you would determine the genotype of the given plant.

(b) (i) Double fertilisation is an event unique to all flowering plants. Explain the process. (ii) Give a reason for the following: (1) A seed of an orange has many embryos. (2) Cashew is a false fruit but Guava is a true fruit.

(a) (i) Describe the arrangement of nuclei and cells in a mature embryo sac of a typical angiosperm. (ii) Explain the devices the flowering plants have developed to prevent the following types of pollination: (1) Prevents both autogamy and geitonogamy (2) Prevents autogamy, but not geitonogamy OR (b) (i) Write the specific location of the following in the testis in humans: (1) Sertoli cells (2) Leydig cells (ii) Explain the coordination between Gonadotropins, Leydig cells and Sertoli cells and their role in spermatogenesis.

Select the option that shows correct statements: (i) Corpus luteum secretes progesterone. (ii) Only FSH attains a peak level in middle of cycle. (iii) LH surge induces rupture of graafian follicle. (iv) Luteal phase of menstrual cycle is also called proliferative phase.

1. Only (ii) is correct.
2. (i) and (iii) are correct.
3. Only (iv) is correct.
4. (ii) and (iv) are correct.

Which connective tissue connects ovary to pelvic wall and uterus?

1. Tendons
2. Ligaments
3. Cartilage
4. Bone

The features of some structures of human male reproductive system are given below. Choose the correct option that matches the features with the structures. (i) It opens into the Vasa efferentia through rete testis. (ii) It carries semen as well as urine. (iii) It maintains temperature (2-2.5°C) lower than body temperature for sperm formation. (iv) It leads to vas deferens that ascends to the abdomen.

1. Seminal vesicle, Urethra, Scrotum, Seminiferous tubule
2. Prostrate, Scrotum, Testes, Vas Deferens
3. Seminiferous tubule, Urethra, Scrotum, Epididymis
4. Seminiferous tubule, Vas Deferens, Urethra, Sertoli cells

If a sperm nucleus is injected into an oocyte then all of the following events are bypassed except

1. The swimming of sperm to meet the egg in the oviduct.
2. The sperm's acquisition of motility in the epididymis.
3. A sperm comes in contact with the zona pellucida layer of the ovum.
4. The complex process like cell division and cell differentiation.

Identify the ploidy of primary spermatocytes formed during spermatogenesis. Select the correct option.

1. Haploid
2. Diploid
3. Triploid
4. Tetraploid

Foetal ejection reflex in human female triggers the release of which hormone?

1. Oxytocin from foetal pituitary gland
2. hCG from placenta
3. Progesterone from corpus luteum
4. Oxytocin from maternal pituitary gland

Select the phase of menstrual cycle in which the remaining parts of Graafian follicle transform into the corpus luteum.

1. Secretory phase
2. Proliferative phase
3. Menstrual phase
4. Ovulatory phase

Which of the following groups of cells in the male gonad represent haploid cells?

1. Spermatogonial cells
2. Germinal epithelial cells
3. Secondary spermatocytes
4. Primary spermatocytes

Assertion (A): After implantation, finger-like projections appear on the trophoblast called chorionic villi. Reason (R): Chorionic villi are surrounded by the uterine tissue and the maternal blood.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

A female undergoing IVF treatment has blocked fallopian tube. The technique by which the embryo with more than 8 blastomeres will be transferred into the female for further development is:

1. ZIFT
2. GIFT
3. IUT
4. AI

The first movements of the foetus and appearance of hair on its head are usually observed during which month of pregnancy?

1. Fourth month
2. Fifth month
3. Sixth month
4. Third month

The foetal ejection reflex in human triggers the release of _________ hormone from __________. Fill in the blanks by choosing right option.

1. oxytocin, foetal pituitary
2. oxytocin, maternal pituitary
3. human chorionic gonadotropin, placenta
4. progesterone, corpus luteum

Assertion (A): The embryo with 8 to 16 blastomeres is called a morula. Reason (R): The morula continues to divide and transform into trophoblast.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

During different phases of menstrual cycle, hormones are secreted. Choose the option showing the correct sequence of hormones.

1. FSH, Progesterone, Estrogen
2. Estrogen, FSH, Progesterone
3. FSH, Estrogen, Progesterone
4. Estrogen, Progesterone, FSH

Assertion (A): The endometrium undergoes cyclic changes during the menstrual cycle. Reason (R): Perimetrium contracts strongly during delivery of the baby.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

during the initial days of lactation is rich in antibody:

1. IgE
2. IgD
3. IgA
4. IgG

During the process of oogenesis in human female, the primary oocyte results in the formation of which of the following?

1. Unequal cells - a smaller haploid secondary oocyte and a larger diploid polar body
2. Unequal cells - a larger haploid secondary oocyte and a smaller haploid polar body
3. Unequal cells - a smaller diploid secondary oocyte and a larger haploid polar body
4. Equal cells - a haploid secondary oocyte and a haploid polar body

Assertion (A): Human male is referred to as heterogametic. Reason (R): The male produces millions of sperms of the same kind.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Penetration of the sperm in the ovum is followed by:

1. Formation of first polar body
2. Completion of Meiosis II
3. First Meiosis
4. Dissolution of zona pellucida

Which one of the following hormones is secreted by the human placenta that helps in the maintenance of pregnancy ?

1. Relaxin
2. Human Chorionic Gonadotropin
3. Oxytocin
4. Human Placental Lactogen

Select the option that has the correct sequence of events of human female reproductive cycle: (i) Secretion of FSH (ii) Ovulation (iii) Growth of corpus luteum (iv) Growth of follicle and oogenesis (v) Sudden increase in LH

1. iiiivivii
2. iivviiiii
3. iviviiiii
4. viiiiiivi

Select the incorrect match from the following: Human Karyotype - Characters

1. 45 + XX - Broad palm with characteristic palm crease
2. 44 + XXY - Overall feminine development
3. 44 + XO - Sterile females as ovaries are rudimentary
4. 44 + XY - Normal male

In humans, the secondary oocyte completes meiotic division when :

1. it gets implanted in the uterine endometrium
2. it is released from the matured Graafian follicle
3. it is penetrated by the sperm cell
4. acrosomal enzymes break down the zona pellucida

In the absence of fertilization, corpus luteum:

1. degenerates
2. produces more oestrogen
3. produces more progesterone
4. produces both oestrogen and progesterone in equal amount

Assertion (A) : The zygote gives rise to heart-shaped embryo and subsequently proembryo in most angiosperms. Reason (R) : The zygote is present at the micropylar end of the embryo sac and develops into an embryo.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

In which one of the following options does the endocrine gland correctly match with its hormonal secretion and its function? Endocrine Gland, Hormone, Function: (a) Sertoli cells, Testosterone, Development of secondary sexual characteristics (b) Placenta, Estrogen, Initiates secretion of milk (c) Leydig cells, Androgen, Initiates the production of sperms (d) Ovary, FSH, Stimulates follicular development

1. Sertoli cells, Testosterone, Development of secondary sexual characteristics
2. Placenta, Estrogen, Initiates secretion of milk
3. Leydig cells, Androgen, Initiates the production of sperms
4. Ovary, FSH, Stimulates follicular development

Which of the following hormones is not secreted by the human placenta ?

1. Progesterone
2. Estrogen
3. Human Chorionic Gonadotropin (HCG)
4. Relaxin

A human ovum completes its second meiosis:

1. at the time of fertilisation
2. when the sperm touches the zona pellucida
3. when the sperm gains entry into the cytoplasm of the ovum
4. when the acrosome of the sperm releases its enzymes on corona radiata

Which of the following options correctly matches the name of the hormone to its site of production in the human body? Name of the Hormone: P. Oxytocin, Q. Relaxin, R. hCG, S. Progesterone; Site of Production: i. Placenta, ii. Corpus Luteum, iii. Pituitary Gland, iv. Ovaries

1. P-i, Q-iii, R-ii, S-iv
2. P-i, Q-iv, R-iii, S-ii
3. P-iii, Q-iv, R-i, S-ii
4. P-ii, Q-iii, R-i, S-iv

Which of the following hormones are active during the ovulatory phase of menstrual cycle in a normal human female?

1. FSH and LH
2. LH and Estrogen
3. FSH and Estrogen
4. Estrogen and Progesterone

(b) Identify the stage of follicle where primary oocyte undergoes first meiotic division. Also mention the products of this division. (2 marks)

(a) Name the muscular and glandular layers of female uterus. Mention one function of each. (2 marks) OR (b) (i) Why are STI (Sexually Transmitted Infections) not detected in time? (1 mark) (ii) Write two complications caused in later stages. (1 mark)

(a) (i) Name the organ that forms a connection between foetus and the uterus of a pregnant human female. (ii) How does it support both nutrition and hormonal regulation ?

Name the organ that forms a connection between foetus and the uterus of a pregnant human female. How does it support both nutrition and hormonal regulation?

(a) The male reproductive system functions with the help of hormones. How does GnRH affect the male reproductive system? OR (b) Various glands are present in the body and they play vital roles in the functioning of the body. Name any two male accessory glands of the male reproductive system. Write one common function of these accessory glands.

Mention the sites of action of the hormones 'GnRH' and 'FSH' during spermatogenesis. Write one function of each of these hormones.

Draw a labelled diagram of the embryonic stage that gets implanted in the human uterus. State the functions of two labelled parts.

(a) (i) Write the function of each of the following: (I) Seminal Plasma (II) Acrosome of human sperm (ii) Differentiate between menarche and menopause.

(a) (i) Explain why the milk produced by the mother during the initial days of lactation is considered to be very essential for the newborn infant. (ii) What is the term used for the milk produced during the initial days of lactation ?

Expand PID. Name any two common viral infections transmitted through sexual contact in human females.

Give reasons for the following: (i) Why can a woman generally not conceive a child after 50 years of age? (ii) Polar bodies are formed during oogenesis and not during spermatogenesis.

Write the basic steps followed in the Assisted Reproductive Technologies (ART) programme to help childless couples. Why is it also known as test tube baby programme ?

What is artificial insemination in ART ? Under what conditions is the person medically advised to go for it ?

Give the schematic representation of oogenesis in human female. Indicate chromosome number also.

Answer the following questions: (a) Write the specific location of vasa efferentia and vas deferens in the male reproductive system. (b) What is a polar body which is formed during oogenesis process in females? When is it first produced? (c) Write the fate of the Graafian follicle after ovulation.

In vitro fertilization (IVF) is a popular method these days that is helping childless couples to bear a child. (a) Write the different steps that are carried out in this technique. (b) Would you consider gamete intra fallopian transfer as a type of IVF? Justify your answer.

(a) Draw a diagram of human ovum prior to fertilization. Label any four parts. (b) Explain how polyspermy is avoided during fertilization.

Draw a sectional view of seminiferous tubule of a human. Label the following cells in the seminiferous tubule: (i) Cells that divide by mitosis to increase their number (ii) Cells that undergo meiosis I (iii) Cells that undergo meiosis II (iv) Cells that help in the process of spermiogenesis. Mention the role of Leydig cells.

Explain the process of formation of placenta in a human female after the implantation of the blastocyst in the endometrium of the uterus.

Explain the neuroendocrine mechanism involved in the process of parturition in a human female leading to the expulsion of the baby out of the uterus through the birth canal.

(a) Name and explain the role of inner and middle walls of the human female uterus. (b) Write the location and function of fimbriae in human female.

(a) "Mother's milk is considered very essential for the new born infant." Justify. (b) What is a 'vaccine' ? Explain the principle on which it works.

Describe any three assisted reproductive techniques practised to treat infertility.

(a) Draw a diagram of a human sperm. Label the following parts in it: (i) Which helps in the motility of the sperm (ii) Which helps in penetrating through the corona radiata and zona pellucida (iii) Which enters into the cytoplasm of the human egg (b) Mention how is polyspermy prevented during the course of fertilization in humans.

Differentiate between spermatogenesis and oogenesis in humans on the basis of the following : (a) When the process is initiated. (b) Number of functional gametes produced per primary spermatocyte/oocyte. (c) Specific site at which meiosis II is completed.

Trace the journey of a zygote from the isthmus of the fallopian tube up to its implantation in the uterus of a human female. Highlight the changes the zygote undergoes during the course of its journey up to implantation.

How is immunity response in humans different from that by antitoxin response? Explain with two reasons.

(a) Trace the events from fertilization till implantation of blastocyst in human female. Also mention the site where fertilization takes place. (5 marks)

Trace the events from fertilization till implantation of blastocyst in human female. Also mention the site where fertilization takes place.

(b) (i) Explain menstrual phase in the menstrual cycle of human female. (ii) Why is follicular phase also called proliferative phase ? (iii) Explain the events that occur in Graafian follicle at the time of ovulation and thereafter. (iv) Draw a Graafian follicle and label – Antrum and secondary oocyte.

Explain menstrual phase in the menstrual cycle of human female. Why is follicular phase also called proliferative phase? Explain the events that occur in Graafian follicle at the time of ovulation and thereafter. Draw a Graafian follicle and label – Antrum and secondary oocyte.

(a) Oogenesis is a discontinuous process that begins before birth and is completed after puberty. (i) Trace the development of a gamete mother cell till its release from the ovary during ovulation. (ii) Name the two pituitary hormones that play an important role in the process.

(a) (i) Draw a neat sectional view of seminiferous tubule of a human testes showing spermatogenesis. Label any five stages. (ii) Explain the hormonal regulation of spermatogenesis process in humans.

(a) Briefly explain the events of fertilisation and implantation in an adult human female.

Explain the structure of testicular lobules in human male reproductive system. Name the two types of cells present in the seminiferous tubules and state their role. Describe the role of hypothalamic hormone GnRH in spermatogenesis.

(b) (i) Name and explain the structural organisation of the male sex accessory ducts in the human male reproductive system. (ii) Describe the role of gonadotropin FSH in the regulation of spermatogenesis.

(b) Describe the changes in the ovary and the uterus as induced by the changes in the level of pituitary and ovarian hormones during menstrual cycle in a human female.

(b) (i) Mention where in the cell these events take place. (ii) Mention why these are needed.

(b)(i) Give the schematic representation of oogenesis in human female indicating chromosome number at each step. (ii) In which part of the female reproductive system do the following events take place? I. Formation of corpus luteum II. Maturation of tertiary follicle III. Fertilisation IV. Implantation

(a) (i) Draw a diagram of a human sperm. Label any four parts and write their functions. (4 marks) (ii) In a human female, probability of an ovum to get fertilized by more than one sperm is impossible. Give reason. (1 mark)

(a) (i) Describe the events of spermatogenesis with the help of a schematic diagram. (ii) Explain the role of hormones in spermatogenesis.

(a) Draw a diagram of a human sperm. Label any four parts and write their functions.

(b) (i) Draw a diagrammatic sectional view of ovary of human female and label the following: (1) Blood vessels (2) Primary follicle (3) Tertiary follicle (4) Ovum (ii) At which stage of life are primary follicles formed in a human female? (iii) Explain the events (both hormonal and structural) that occur at the time of ovulation till the onset of the next menstrual cycle.

Draw a labelled diagram of the embryonic stage that gets implanted in the human female leading to pregnancy. Explain the changes that the different parts of the embryo undergo after implantation up till (1) Placenta formation and (2) formation of three germ layers. Mention the role of the following : (1) Placenta (2) Three germ layers

(b) (i) Mention the site where fertilisation of the ovum occurs in a human female. Explain the process of fertilization and mention how polyspermy is prevented. (ii) Name the embryonic stage that gets implanted in the uterus. Explain the process of implantation in a human female.

(b) (i) Mention the site where fertilisation of the ovum occurs in a human female. Explain the process of fertilization and mention how polyspermy is prevented.

(b) Explain the ovarian and uterine events taking place along with the role of pituitary and ovarian hormones, during menstrual cycle in a normal human female under the following phases : (i) Follicular phase/proliferative phase (ii) Luteal phase/secretory phase (iii) Menstrual phase

(a) (i) Explain the following phases in the menstrual cycle of a human female: (1) Menstruation (2) Follicular phase (3) Luteal phase (ii) 'A proper understanding of the menstrual cycle can help immensely in family planning.' Do you agree with the statement ? Provide reasons for your answer.

How many of the following features are related to Nirodh – a popular brand of condoms ? (i) Prevention of sexually transmitted infections. (ii) Phagocytosis of sperms. (iii) Male contraceptive device. (iv) Acts as chemical barrier. (v) Physiological changes in cervical mucus.

1. (i), (ii), (iv)
2. (i) and (iii)
3. (i), (ii), (v)
4. (ii) and (iv)

The method of contraception that is hormone-based and prevents ovulation is :

1. Oral Pills
2. Copper-T
3. Condom
4. Lippes loop

A female undergoing IVF treatment has blocked fallopian tube. The technique by which the embryo with more than 8 blastomeres will be transferred into the female for further development is:

1. ZIFT
2. GIFT
3. IUT
4. AI

A man is found to have a sperm count of less than 20 million/mL and his wife is diagnosed with blockage in the oviduct. This couple would be advised to go for which of the following techniques? (i) ZIFT (ii) AI (iii) IUT (iv) ICSI (v) GIFT

1. (i) and (iii)
2. (ii) and (iii)
3. (iii) and (iv)
4. (iv) and (v)

Match the IUDs in Column I with suitable example in Column II. Column I: a. Non-medicated, b. Copper releasing, c. Hormone releasing. Column II: i. Lippes loop, ii. LNG-20, iii. Multiload 375.

1. a-iii, b-ii, c-i
2. a-i, b-ii, c-iii
3. a-i, b-iii, c-ii
4. a-ii, b-i, c-iii

Assertion (A): Copper-T increases phagocytosis of sperms. Reason (R): It is a non-steroidal preparation.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): increases phagocytosis of sperms. Reason (R): It is a non-steroidal preparation. Select the correct answer to these questions from the codes (A) Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A). (B) Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A). (C) Assertion (A) is true, but Reason (R) is false. (D) Assertion (A) is false, but Reason (R) is true.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A)
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A)
3. Assertion (A) is true, but Reason (R) is false
4. Assertion (A) is false, but Reason (R) is true

Assertion (A): It is possible to obtain virus-free plants from an infected plant. Reason (R): If the plant is infected with a virus, the roots and the stems are free of virus. Select the correct answer.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): Estrogen increases phagocytosis of sperms. Reason (R): It is a non-steroidal preparation. Select the correct answer.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): Cu-T, Cu-7 and LNG-20 are the most widely used copper-releasing IUDs. Reason (R): Cu-ions in IUDs effectively suppress sperm motility and the fertilising capacity of sperms.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A) : Mode of action of pills and implants/injectables is similar. Reason (R) : The effective period of pills is much longer as compared to implants/injectables.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A) : avoiding chances of ovum and sperm meeting. Reason (R) : It is made of thin rubber/latex sheath and is used to cover the penis before coitus.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

The source of 'Smack' is:

1. Leaves of Cannabis sativa
2. Flowers of Datura
3. Fruits of Erythroxylum coca
4. Latex of Papaver somniferum

The periodic abstinence by a couple for family planning should be from :

1. Day 5 to 10 of menstrual cycle
2. Day 13 to 15 of menstrual cycle
3. Day 10 to 17 of menstrual cycle
4. Day 16 to 20 of menstrual cycle

Assertion (A): The laws of our country permit legal adoption and it is as yet, one of the best methods for childless couples looking for parenthood. Reason (R): Emotional, religious and social factors are no deterrents to the legal adoption of orphaned and destitute children in India.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Which of the following sexually transmitted disease is not caused by a virus ?

1. Genital herpes
2. Gonorrhoea
3. Genital warts
4. Hepatitis-B

Assertion (A) : Breast-feeding is advised by the doctor as it is essential for the new borns. Reason (R) : Colostrum secreted by the mother during initial days of lactation has abundant antibodies containing IgE and IgG.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

(b) A girl develops sneezing, watery eyes and difficulty in breathing every time she visits a flower garden. (i) Identify the condition. (ii) Name the immune component responsible for this condition. (iii) Name the chemical released. (iv) State one medicine used to treat such a condition.

How do 'implants' act as an effective method of contraception in human females? Mention one advantage of implants over contraceptive pills.

Define the term 'amniocentesis'. Why has the government imposed a statutory ban in spite of its importance in the medical field?

Explain what is meant by the term MTP. What was the main reason to legalize MTP by the Government of India?

Write two features of an ideal contraceptive. Explain any one natural contraceptive method that makes the chances of conception almost nil.

(b) Other than public awareness and counselling, enlist four measures taken up by NACO, WHO and other NGOs to prevent the spread of HIV infection in the society.

(a) Explain what is meant by the term amniocentesis. How is this technique misused in India?

(a) Explain what is meant by the term amniocentesis. How is this technique misused in India ? OR (b) Name any two VDs which might occur in a human female. State any two complications in a female if it is left untreated.

(a) Why are restrictions imposed on MTP in India ? Up to how many weeks or trimesters, is MTP considered relatively safe for a female, if necessary to perform, by a medical practitioner ?

A farmer while working on his farm was bitten by a poisonous snake. He was rushed to a nearby health centre where the doctor gave him an injection to save his life. (i) What did the doctor inject and why? (ii) Name the kind of immunity provided by this injection.

Write the basic steps followed in the Assisted Reproductive Technologies (ART) programme to help childless couples. Why is it also known as test tube baby programme ?

(a) Name any two copper releasing intra-uterine devices. State two reasons that make them effective contraceptives.

Oral contraceptives are widely accepted for controlling the increasing rate of population. Name the two important components of oral contraceptives used by women ?

What is a vaccine ? Write the basis on which it acts when administered in the body.

State the procedure followed in the technique of amniocentesis. List any two advantages of this technique.

Amniocentesis is a very useful and important technique, but due to some reason there is a statutory ban on amniocentesis. Justify this statement.

(a) Intensely lactating mothers generally do not conceive. Why ? (b) Our government has intentionally imposed strict conditions for MTP. Why ?

(a) Explain the Intrauterine Insemination method. OR (b) Explain how recombinant DNA technology is used to detect a disease even before any clinical symptom appears.

State the mode of action of cocain on human body. Write the scientific name of the source plant it is obtained from.

A village health worker was taking a session with women. She tells them that one has to be careful while using oral pills as a method of birth control. Wrong usage can actually promote conception. (a) Analyse the above statement and compare the merits and demerits of using oral pills and surgical methods of birth control. (b) Village women are confused as to how a thin metallic copper loop can provide protection against pregnancy. Explain the mode of action of IUDs. Give two points.

(a) What is an in vitro fertilization (IVF) and write its importance. (b) Distinguish between GIFT and ZIFT.

Explain the IUI and IUT methods of assisted reproductive technologies.

Explain the mode of action of contraceptive pills taken by human females. Mention the schedule to be followed for effective outcome.

(b) In case of any dispute, a very small sample of tissue or even a drop of blood can help us to determine the paternity of a child. Provide a scientific explanation to substantiate the statement.

(a) State the importance of IVF. (b) Distinguish between GIFT and ZIFT.

(a) (i) Expand the abbreviations given below, used for different modes of assisted reproductive technologies : (1) ZIFT (2) ICSI (3) IUT (4) GIFT (ii) Which one of them cannot be considered as a procedure of IVF ? Give reasons in support of your answer.

(a) (i) Expand the abbreviations given below, used for different modes of assisted reproductive technologies: (1) ZIFT (2) ICSI (3) IUT (4) GIFT (ii) Which one of them cannot be considered as a procedure of IVF? Give reasons in support of your answer. OR (b) Differentiate between the following: (i) Perisperm and Pericarp (ii) Syncarpous pistil and Apocarpous pistil (iii) Plumule and Radicle

Expand and explain the following techniques used in human reproduction: (a) GIFT (b) ZIFT (c) IUI

Expand and explain the following techniques used in assisted reproduction: (a) GIFT (b) ZIFT (c) IUI

Expand and explain the following techniques used in test tube baby programme: (a) GIFT (b) ZIFT (c) IUI

(b) (i) Case studies of some couples are given below. They were not able to have kids even though the parents were not taking any precautions. They also do not wish to adopt a child or take the help of donors. Study these cases and suggest an appropriate Assisted Reproductive Technology that could help them. Case I – Female – Normal Reports / Male – Normal sperms but no connection between epididymis and vas deferens. (1 mark) Case II – Female – Normal eggs but Fallopian tube blocked. / Male – Normal sperms. Male reports are normal. (1 mark) Case III – Female – Normal Reports. / Male – Low sperm count with less motility. (1 mark) (ii) Copper releasing intrauterine devices are very effective and popular contraceptive devices. Name any two copper releasing IUDs. Write two reasons that make them effective contraceptives. (2 marks)

(a) (i) What is the 'RCH' programme and what is its motive? (ii) Make a list of five steps to implement the programme and to create awareness among the people about reproduction-related aspects. (iii) Which test in this field is meant for useful study but is misused by people? Write the importance of this test. OR (b) (i) Write the average duration of human pregnancy. By what name is this period known as? (ii) Explain the terms Menarche and Menopause. (iii) Name and explain the sterilisation methods in males and females.

(b) Medical Termination of Pregnancy (MTP) plays an important role in reproductive health. (i) What is MTP ? (ii) Under what conditions is it legally permitted in India ? Mention any two points. (iii) In which stage of pregnancy is MTP considered legally and medically safe ? (iv) Explain any two risks/concerns associated with this process.

In a dihybrid cross, 2400 individuals are produced in F2 generation. Approximately how many will be phenotypically similar to parents ?

1. 2000
2. 1500
3. 580
4. 450

A woman having genes for haemophilia on one X chromosome and a gene for colour blindness on another X chromosome marries a normal man. The progeny will show

1. 50% haemophilic and colour-blind sons, 50% normal sons.
2. 50% haemophilic carrier daughter, 50% colour-blind carrier daughters.
3. All sons and daughters colour-blind and haemophilic.
4. Only haemophilic and colour-blind daughters.

Which of the following traits studied by Mendel in pea plant is a recessive trait?

1. Tall stem
2. Green pod
3. Green seed
4. Violet flower

When glutamic acid changes to valine at the 6th position of the beta globin chain of haemoglobin, it results in a genetic disorder. Choose the option that indicates the correct disorder.

1. Thalassemia
2. Phenylketonuria
3. Sickle cell anaemia
4. Haemophilia

A person has a short stature with small round head, furrowed tongue and partially open mouth. Select the option indicating the chromosomal disorder.

1. Turner's syndrome
2. Klinefelter's syndrome
3. Down's syndrome
4. Dwarfism

What would be the minimum possibility of a dominant trait being expressed in an offspring after a monohybrid test cross ?

1. 25%
2. 50%
3. 75%
4. 100%

Select the correct statement. All genes located on the same chromosome:

1. form different groups depending upon their relative distance.
2. form one linkage group.
3. will not form linkage groups.
4. form interactive groups that affect the phenotype.

Assertion (A): The human blood group 'AB' exemplifies co-dominance. Reason (R): The gene for human blood group trait exists in three allelic forms IA, IB and i.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Which one of the following statements is correct?

1. Homozygous sex chromosomes (ZZ) determine female sex in birds.
2. XO type of sex chromosomes determine male sex in grasshoppers.
3. XXY condition in humans is found in Turner's syndrome.
4. Homozygous sex chromosomes (XX) produce males in Drosophila.

In Pisum sativum, the flower colour may be violet (V) or white (v). What proportion of the offspring in a cross of 'VV' × 'vv' would be expected to be violet?

1. 25%
2. 50%
3. 75%
4. 100%

If a genetic disease is transferred from a phenotypically normal but carrier female to only some of the male progeny, the disease is:

1. autosomal dominant
2. autosomal recessive
3. sex-linked dominant
4. sex-linked recessive

In a pea plant (Pisum sativum) inflated pod shape is dominant over constricted pod shape. The expected ratio of phenotypes of the offspring in a cross between both the parents with heterozygous inflated pod shape will be:

1. 1 : 0
2. 1 : 1
3. 2 : 1
4. 3 : 1

Assertion (A): ABO blood grouping in humans is an example of multiple allelism. Reason (R): More than two genes in a population govern the same character in ABO blood grouping in humans.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

A colourblind man marries a woman with normal sight who has no history of colourblindness in her family. What is the probability of their son being colourblind?

1. 0.5
2. 1
3. Nil
4. 0.25

In pea plant (Pisum sativum) axial flower position is dominant over terminal flower position. The expected ratio of phenotypes of the offspring in a cross between both the parents with heterozygous axial flower will be:

1. 3 : 1
2. 2 : 1
3. 1 : 1
4. 1 : 0

Assertion (A): ABO blood grouping in humans is an example of multiple allelism. Reason (R): More than two genes in a population govern the same character in ABO blood grouping in humans. Select the correct answer to these questions from the codes (A) Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A). (B) Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A). (C) Assertion (A) is true, but Reason (R) is false. (D) Assertion (A) is false, but Reason (R) is true.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A)
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A)
3. Assertion (A) is true, but Reason (R) is false
4. Assertion (A) is false, but Reason (R) is true

Thalassemia and Sickle Cell Anaemia are both caused due to problem in globin molecule synthesis. Select the correct statement:

1. Both are due to a quantitative defect in globin chain synthesis.
2. Thalassemia is due to less synthesis of globin molecules.
3. Sickle cell anaemia is due to a quantitative problem of globin molecules.
4. Both are due to qualitative defect in globin chain synthesis.

In a pea plant (Pisum sativum) green pod colour is dominant over yellow pod colour. The expected ratio of phenotypes of the first generation offspring in a cross between both the parents with heterozygous green pod colour will be:

1. 0 : 1
2. 1 : 1
3. 2 : 1
4. 3 : 1

Assertion (A): ABO blood grouping in humans is an example of multiple allelism. Reason (R): More than two genes in a population govern the same character in ABO blood grouping in humans. Select the correct answer.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): Gene pairs present on the same chromosome may be tightly linked or loosely linked. Reason (R): Frequency of recombination between gene pairs on different chromosomes as a measure of the distance the chromosomes.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Match the terms in Column-I with their description in Column-II and choose the correct option. Column-I (Terms): a. Dominance, b. Codominance, c. Pleiotropy, d. Polygenic inheritance. Column-II (Descriptions): (i) Many genes govern a single character. (ii) In a heterozygote organism, only one allele expresses itself. (iii) In a heterozygous organism, both alleles express themselves fully. (iv) A single gene influences many characters.

1. a-(ii), b-(iii), c-(iv), d-(i)
2. a-(iv), b-(i), c-(ii), d-(iii)
3. a-(iv), b-(iii), c-(i), d-(ii)
4. a-(ii), b-(i), c-(iv), d-(iii)

In a pea plant (Pisum sativum), green pod colour is dominant over yellow pod colour. The expected ratio of the phenotypes of the offsprings (F1) in a cross between parents with heterozygous green pod colour and homozygous yellow pod will be :

1. 1 : 1
2. 2 : 1
3. 3 : 1
4. 4 : 1

Which of the following do not follow the law of independent assortment ?

1. Genes on non-homologous chromosomes and absence of linkage
2. Two or more genes on homologous chromosomes
3. Linked genes located on the same chromosomes
4. Two or more distant genes present on the same chromosome

Assertion (A) : In dihybrid crosses involving sex-linked genes in Drosophila generation of non-parental gene combinations are observed. Reason (R) : Two genes present on different chromosomes show linkage and recombination in Drosophila.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

When a pure tall pea plant (Pisum sativum) with green pod is crossed with dwarf pea plant with yellow pod, how many dwarf pea plants, out of 16, will be produced in F2 generation ?

1. 9
2. 3
3. 4
4. 1

Inheritance of which of the following traits is shown in the cross given below ? XY (Normal man) XXC (Carrier woman) XXC (Carrier daughter) XX (Normal daughter) XY (Normal son) XCY Genetic disorders (Diseased son)

1. Autosomal recessive trait
2. X-linked dominant trait
3. X-linked recessive trait
4. Autosomal dominant trait

In a pedigree chart, if two unaffected individuals have a child with the trait, what is the most likely mode of inheritance for this trait ?

1. Autosomal dominant
2. Autosomal recessive
3. X-linked dominant
4. X-linked recessive

A normal couple produces half the sons as haemophilic and half the daughters as carriers. Choose the option that correctly indicates the chromosome on which the gene for this trait is located.

1. X-chromosome of father
2. Y-chromosome of father
3. One X-chromosome of mother
4. Both the X-chromosomes of the mother

Which of the following conditions correctly describes the manner of determining the sex in the given options?

1. Homozygous sex chromosomes (ZZ) determine female sex in birds.
2. XO type of chromosomes determine male sex in grasshoppers.
3. XO condition in humans determines female sex.
4. Homozygous sex chromosomes (XX) produce male in Drosophila.

Assertion (A): A male individual always inherits haemophilia from his mother. Reason (R): The gene for haemophilia lies on X-chromosome.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

A dwarf pea plant was treated with gibberellic acid and it becomes as tall as a tall pea plant. If these treated pea plants are crossed with pure tall pea plants, the phenotypic ratio in F1 generation will be:

1. All tall
2. 50% tall, 50% dwarf
3. 75% tall, 25% dwarf
4. 25% tall, 75% dwarf

In a certain population, the frequency of three genotypes is as follows: Genotypes: PP Pp pp Frequency: 22% 62% 16%. Choose the option that shows the frequency of P and p alleles correctly:

1. 53% 47%
2. 47% 53%
3. 40% 46%
4. 22% 16%

A single gene that controls the expression of more than one trait is said to show

1. Multiple allelism
2. Polygenic inheritance
3. Incomplete dominance
4. Pleiotropism

A person with trisomy of 21st chromosome shows

1. (ii) and (iv)
2. (i), (ii) and (iv)
3. (ii) and (iii)
4. (i) and (ii)

If both the parents are carriers for thalassaemia, the chances of an afflicted child to be born to them is:

1. 25%
2. 50%
3. 75%
4. 100%

Assertion (A): In birds the sex of the offspring is determined by males. Reason (R): Males are homogametic while females are heterogametic.

1. Both (A) and (R) are true and (R) is the correct explanation of (A).
2. Both (A) and (R) are true, but (R) is not the correct explanation of (A).
3. (A) is true, but (R) is false.
4. (A) is false, but (R) is true.

Which one of the following chromosomal event will not result in genetic variation amongst the offsprings ?

1. Independent assortment
2. Crossing over
3. Linkage
4. Mutation

The human chromosome with the highest and least number of genes in them are respectively:

1. Chromosome 21 and Y.
2. Chromosome 1 and X.
3. Chromosome 1 and Y.
4. Chromosome X and Y.

Select the incorrect match from the following: Human Karyotype and Characters

1. 45 + XX — Broad palm with characteristic palm crease
2. 44 + XXY — Overall feminine development
3. 44 + XO — Sterile females as ovaries are rudimentary
4. 44 + XY — Normal male

Assertion (A): Linked genes do not show dihybrid F2 ratio 9 : 3 : 3 : 1. Reason (R): Linked genes do not undergo independent assortment.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Select the incorrect match from the following : Human Karyotype | Characters

1. 45 + XX | Broad palm with characteristic palm crease
2. 44 + XXY | Overall feminine development
3. 44 + XO | Sterile females as ovaries are rudimentary
4. 44 + XY | Normal male

Match the items in Column I with those in Column II and select the correctly matched option from those given below : Column I Cross Column II Phenotypic Ratio 1. Mendelian monohybrid (i) 1 : 2 : 1 (F2) 2. Mendelian dihybrid (ii) 1 : 1 3. Incomplete dominance (iii) 3 : 1 (F2) 4. Test cross (monohybrid) (iv) 9 : 3 : 3 : 1 (F2)

1. 1(ii), 2(iv), 3(i), 4(iii)
2. 1(iii), 2(i), 3(iv), 4(ii)
3. 1(iii), 2(iv), 3(i), 4(ii)
4. 1(ii), 2(i), 3(iv), 4(iii)

A woman with normal vision has a colour blind father. She marries a man with normal vision. The percentage chance of their progeny being colour blind is :

1. 25%
2. 50%
3. 75%
4. 100%

The expected phenotypic ratio amongst the progeny of 60 individuals, obtained from a cross between heterozygous tall pea plant and dwarf pea plant is:

1. 45 tall and 15 dwarf
2. 40 tall and 20 dwarf
3. 30 tall and 30 dwarf
4. 35 tall and 25 dwarf

A Snapdragon plant bearing pink colour flowers is crossed with a Snapdragon plant bearing white colour flowers. The expected phenotypic percentage of the offspring is :

1. 50% Red : 50% White
2. 25% Red : 50% Pink : 25% White
3. 50% Pink : 50% White
4. 25% Pink : 50% Red : 25% White

In which of the given chromosomal disorders does the individual have tall stature with feminised character ?

1. Noonan syndrome
2. Down syndrome
3. Turner syndrome
4. Edwards syndrome

A Snapdragon plant bearing red colour flowers was crossed with a Snapdragon plant bearing white colour flowers. The F1 progeny on selfing produced the progeny in the ratio of :

1. 50% Red : 50% White
2. 25% Pink : 50% White : 25% Red
3. 50% Red : 50% Pink
4. 25% Red : 50% Pink : 25% White

In which of the following chromosomal disorders do individuals have short stature, underdeveloped feminine character and sterile ovaries ?

1. Down syndrome
2. Turner syndrome
3. Klinefelter syndrome
4. Patau syndrome

In which of the following chromosomal disorders do the individuals have short stature, small head, furrowed tongue and partially open mouth ?

1. Turner syndrome
2. Down syndrome
3. Klinefelter syndrome
4. Edwards syndrome

A Snapdragon plant bearing pink colour flowers is crossed with a Snapdragon plant bearing white colour flowers. Their F1 progeny will show :

1. 25% Red : 50% Pink : 25% White
2. 50% Red : 50% White
3. 50% Pink : 50% White
4. 25% Pink : 50% Red : 25% White

Turner's syndrome in humans occurs due to

1. Aneuploidy
2. Euploidy
3. Polyploidy
4. Autosomal abnormality

Which of the chromosome in a human possesses the least number of genes ?

1. 21st chromosome
2. 16th chromosome
3. X-chromosome
4. Y-chromosome

Which one of the following processes results in the production of recombinants in future generations? (i) Mutation (ii) Independent assortment during meiosis I (iii) Independent assortment during meiosis II (iv) Crossing over of bivalents

1. (iv) only
2. (ii) and (iv)
3. (i), (ii) and (iii)
4. (i), (ii), (iii) and (iv)

Assertion (A): Birds like pigeon have heterogametic females whereas the males are homogametic. Reason (R): In pigeons, females have Z and W sex chromosomes whereas males have ZZ sex chromosomes.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Choose the set of sex determining chromosomes that indicates the correct sex of the respective organism.

1. Homozygous sex chromosomes (ZZ) determine female sex in birds
2. XO type of sex chromosomes determine male sex in grasshoppers
3. XXY condition in humans, as found in Turner Syndrome, determines male sex
4. Homozygous sex chromosomes (XX) produce male sex in Drosophila

DNA profiles of the child and three individuals 1, 2 and 3 who claim to be the parents of the child are given below. Select the option that shows the correct actual parent/parents of the child.

1. Individual 1 and 3
2. Individual 1 and 2
3. Individual 2 and 3
4. Individual 1 is the only parent of the child amongst 1, 2 and 3

Assertion (A): In humans the genotype with all the dominant alleles (AABBCC) will have the darkest skin colour. Reason (R): In a polygenic trait, phenotype reflects the contribution of each allele.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Which of the following statements are true about the males in a colony of honey bees? (i) They have 16 chromosomes per cell. (ii) They produce sperms by meiosis. (iii) They have a grandfather but no father. (iv) All males in the colony are haploid except one.

1. (i) and (iii) only
2. (ii) and (iii) only
3. (iii) and (iv) only
4. (ii) and (iv) only

Assertion (A) : In a monohybrid cross between tall plants and dwarf plants, the F2 generation showed tall and dwarf plants in the ratio of 3 : 1. Reason (R) : There is no blending of traits/characters in the F2 generation.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

(a) Analyse the following two cases of sex determination in different organisms: Case I: Males have (XO) sex chromosomes and females have two copies of same sex chromosome (XX). Case II: Females have two different sex chromosomes (ZW) and males have two copies of same sex chromosome (ZZ). Identify the type of heterogamety in each case, giving one example of each. (1 + 1 marks)

(a) Analyse the following two cases of sex determination in different organisms: Case I: Males have (XO) sex chromosomes and females have two copies of same sex chromosome (XX). Case II: Females have two different sex chromosomes (ZW) and males have two copies of same sex chromosome (ZZ). Identify the type of heterogamety in each case, giving one example of each. (1+1 marks) OR (b) (i) Differentiate between a DNA and RNA nucleotide. (1 mark) (ii) Name the two types of bonds present within a single nucleotide. (1 mark)

Mendel published his work on inheritance in 1865, but it remained unnoticed for over three decades. State the reasons why his work was not recognised during his life time. (4 points)

Is it possible for a trait to be inherited by an organism but not expressed in its phenotype? Justify and illustrate your answer with a suitable Mendelian Cross.

(a) Explain the mechanism of sex-determination in insects like Drosophila and Grasshopper. OR (b) How does a chromosomal disorder differ from a Mendelian disorder? Name any two chromosomal disorders.

What did Henking observe in his experiments on insects that led to the discovery of sex chromosome? How did his observation contribute to our understanding of sex determination?

State any four reasons why Mendel succeeded in his genetic hybridisation experiments on garden peas.

(a) Write the scientific name of the fruit fly. (b) Why did Morgan prefer to work with fruit flies for his experiments? State two reasons.

If the base adenine constitutes 31% of an isolated DNA fragment, then write what will be the expected percentage of the base cytosine in it. Explain how did you arrive at the answer given.

Although Haemophilia and sickle cell anemia are two blood related Mendelian disorders, yet, they differ in their pattern of inheritance. State any two differences.

(a) Give the scientific name of the organism used by Morgan to study sex-linked traits. (b) Write any four reasons why this organism made it an ideal experimental model.

Give the scientific name of the organism used by Morgan to study sex-linked traits. Write any four reasons why this organism made it an ideal experimental model.

(a) Describe the experiment conducted by T.H. Morgan on Drosophila melanogaster involving eye colour and body colour. (b) How did the results deviate from Mendelian inheritance pattern? (c) Explain the two genetic terms used by Morgan for his observations.

Explain the polygenic inheritance pattern with the help of a suitable example.

Gregor Mendel conducted hybridisation experiments in garden pea for seven years and proposed the law of inheritance. (a) Why was he successful in his hybridisation experiments? Give two reasons. (b) State the law of independent assortment as proposed by Mendel after his dihybrid crosses.

Thomas Hunt Morgan carried out several dihybrid crosses in Drosophila melanogaster to study genes that were sex linked. (a) Give four major reasons for using the tiny fruit flies by Morgan for his experiments. (b) How did Morgan and his group explain the physical association of the two genes on a chromosome to the frequency of recombination between gene pairs on the same chromosome?

Gregor Mendel used true-breeding pea lines to conduct his hybridisation experiments in garden pea. (a) Explain what is meant by true-breeding pea lines. (b) State the three important points of law of dominance as proposed by Gregor Mendel.

During a medical investigation, an infant was found to possess an extra copy of chromosome no. 21. Identify the disorder the child is suffering from. Describe the symptoms the child is likely to develop later in life.

Name a blood related autosomal Mendelian disorder. Why is it called as Mendelian disorder ? How is the disorder transmitted from parents to offspring ?

Name one commonly occurring genetic disorder in humans which is caused due to monosomy (one chromosome less than the normal number of chromosomes) of sex chromosome. Give its two symptoms.

Answer the following questions with respect to the sex determining mechanism observed in honey bee. (a) Name the type of sex determination system observed in honey bee. (b) Fill in the blanks (i), (ii) and (iii) in the given question. Parent Male: Type of cell division involved during gamete formation in males (i) _____________, Number of chromosomes in the gametes (ii) _____________, Number of chromosomes in the diploid cell of the progeny (iii) _____________. (c) What will be the sex and chromosome number of the progeny formed from the unfertilised eggs of honey bee ?

Answer the following questions with respect to the sex determining mechanism observed in honey bee. (a) What is the type of cell division involved in the formation of gametes in a female bee and a male bee respectively ? (b) Name the type of sex determination system observed in honey bee. (c) What is the sex of honey bee formed from the unfertilised eggs ? Write the number of chromosomes present in it.

Expression of different genes for different traits may show dominance, incomplete dominance or co-dominance. Write about expression of such genes with the help of one example each.

In a family, the father, the daughter and the son are colour blind, whereas the mother has normal vision. Do you think the son and the daughter have inherited the disease from their father ? Work out a cross to justify your answer.

(a) (i) Write the karyotype and the genetic disorder of an individual who has XXY sperm fertilizing an X egg. (ii) Mention any two symptoms of this genetic disorder. (iii) Write the possible reason that leads to the formation of this type of aneuploidy.

Explain the mechanism of haplo-diploid pattern of sex determination with the help of a suitable example. Why is this pattern so called?

Human blood group (ABO group) inheritance is a good example of multiple allelism and co-dominance. Justify the statement.

(a) (i) Write the karyotype and the genetic disorder of an individual who has XXY (fertile Y). (ii) Mention any two symptoms of this genetic disorder. (iii) Write the possible reason that leads to the formation of this condition.

Three crosses were carried out in pea plants with respect to flower colour violet/white (V/v) and flower position axial/terminal (A/a). Study in the table the crosses 1, 2 and 3 where parental phenotypes and F1 progeny phenotypes are given. Parental plants (Phenotypes) | F1 Progeny (Phenotypes) (a) Violet, axial × white, axial | 6/16 white, axial; 2/16 white, terminal; 6/16 violet, axial; 2/16 violet, axial (b) Violet, axial × white, terminal | 1/4 violet, axial; 1/4 violet, terminal; 1/4 white, axial; 1/4 white, terminal (c) Violet, axial × violet, axial | 3/4 violet, axial; 1/4 white, axial Work out the genotypes of each parent in each cross.

Three crosses were carried out in pea plants with respect to flower colour violet/white (V/v) and flower position axial/terminal (A/a). Study in the table the crosses and F1 progeny phenotypes are given. Parental plants (Phenotypes) and F1 Progeny (Phenotypes) are given. For each cross and F1 progeny, decipher the genotype of the parent and F1 generation (Find out).

Three crosses were carried out in pea plants with respect to flower colour violet/white (V/v) and flower position axial/terminal (A/a). Study in the table the crosses 1 and 2 where parental plants phenotypes and F1 progeny phenotypes are given. Find the genotypes of each cross.

(a) A man with blood group 'A' marries a woman with blood group 'AB'. The first child born to them has blood group 'B'. Work out a cross to find the genotype of the father. Give the possible blood groups and their genotypes of the children that could be born to this couple. (Use a Punnet square). (b) State the basis of 'ABO' blood grouping in humans.

With reference to flower colour two independent crosses were made, one between true breeding garden pea plants and another between true breeding Antirrhinum plants. Write the phenotypes of their F1-progeny. Justify your answer giving reason.

A pea plant with purple flowers, when crossed with a plant with white, produced 50 plants with only purple flowers. On selfing these plants produced 482 plants with purple flower and 162 with white flowers. Explain the pattern of inheritance with the help of Punnet square.

(b) In a particular cattle, the coat colour red and white are controlled by single pair of alleles. A calf that receives allele for red coat from mother and allele for white coat from father shows equal number of red and white hairs on its coat. (i) Is this an example of Co-dominance or incomplete dominance. Give a reason for your answer. (ii) With the help of a genetic cross upto F 2 generation, explain what will be the consequent phenotype of calf when (1) Red is dominant over white, (2) Red is incompletely dominant.

How would you find out whether a given tall garden pea plant is homozygous or heterozygous? Substantiate your answer with the help of Punnet square.

(b) The following questions are based on haemophilia. (i) Work out the crosses between: (I) Normal female and Haemophilic male (II) Carrier female and Normal male (III) Carrier female and Haemophilic male (ii) Write the conclusions you draw from these crosses. Comment on the type of inheritance of the disease. (Use: X – Normal, Xh – Haemophilic)

(b) (i) What are multiple alleles ? How do they differ from simple dominant-recessive allele pairs ? (ii) Explain the concept of multiple alleles with the help of a human trait studied by you. (iii) Mention all possible genotypes with their corresponding phenotypes of the human trait as explained by you. (iv) Comment on the type of inheritance pattern involved in the example explained by you.

(a) Write the types and locations of the genes causing thalassemia in humans. State the cause and symptoms of the disease. How is sickle-cell anemia different from this disease?

(a) Work out separate monohybrid crosses up to F₂ generation between two pea plants and two Antirrhinum plants, both having contrasting traits with respect to the colour of the flower. Comment on the patterns of inheritance in the crosses carried out in such two cases.

Differentiate between the following: (i) Polygenic Inheritance and Pleiotropy (ii) Dominance, Codominance and Incomplete dominance

(a) (i) What is a test cross? How can we find out the zygosity of a plant by the use of test cross?

(a) Work out a dihybrid cross upto F2 generation between pea plants bearing violet coloured axial flowers and white coloured terminal flowers using Punnet's square. Give their F2 phenotypic ratio. State the Mendel's law of inheritance that was derived from such a cross.

(a) Many patterns of inheritance deviate considerably from the pattern of inheritance as explained by Mendel. List any four such inheritance patterns and explain any three with the help of an example each.

Stability, as one of the properties of genetic material, was very evident in one of the very early experiments in genetics. Name the scientist and describe his experiment. State the conclusion he arrived at.

(a) (i) Compare the pattern of inheritance of flower colour in garden pea plant (violet/white) with snapdragon plant (red/white) on the basis of the following : (1) F1 phenotypic expression; (2) expected phenotypic and genotypic expression of F2 generation; (3) the conclusion you reached at the end of the comparison made. (ii) List any two characteristics of pattern of inheritance of human blood group ABO.

(a) (i) State the law of independent assortment. (ii) Explain this law by taking the example of a cross between two heterozygous parents of pea plants with respect to flower colour and flower position using Punnett Square.

(a) Explain codominance with reference to ABO blood group in humans.

(a) In a heterozygous condition, the effect of both alleles is exhibited clearly in codominance. Explain the statement using the example of ABO blood group in humans. OR (b) (i) In the promoter region (operon) a group of genes are regulated and expressed as a single unit. Explain the procedure/process of initiation of the activity of structural genes of lac operon (lac switch-on). (ii) lac operon is said to be under negative regulation. Explain with reason.

(a) In heterozygous condition, the effect of both alleles is observed manifested in codominance. Explain the statement with the help of human ABO blood group in humans. OR (b) In prokaryotes, a group of genes are regulated and expressed together as a unit in lac operon. (i) Explain the mechanism of switching on (ON state) of the structural genes of lac operon. (ii) The regulation of lac operon is called as negative regulation. Why ?

(b) (i) A true breeding tall pea plant with round seeds is crossed with a recessive dwarf pea plant having wrinkled seeds. Work out the cross up to F2 generation giving the phenotypic ratios of F1 and F2 generation respectively. (ii) State the Mendelian principle that can be derived only with the help of such a cross.

(b) You are given a tall pea plant and asked to determine its genotype. Name and explain the cross that you will carry out to find the possible genotype of the given tall pea plant.

(b) A homozygous tall pea plant with green seeds is crossed with a homozygous dwarf pea plant with yellow seeds. (i) Write the possible phenotype and genotype of F1 generation. (ii) State the laws of Mendel that are proved true by the F1 generation. (iii) Mention the F2 phenotypic ratio along with their possible phenotypes. (iv) Write the genotypes of the male and female gametes produced by F1 progeny.

Which of the following statements about plasmids is incorrect?

1. Plasmids have the ability to replicate within the bacterial cell.
2. Their replication is controlled by chromosomal DNA.
3. They are autonomously replicating circular extra-chromosomal DNA.
4. They often carry antibiotic resistant genes.

Messelson and Stahl's experiment carried out centrifugation in CsCl2 density gradient to separate:

1. DNA from RNA
2. DNA from protein
3. RNA from protein
4. Normal DNA from heavy DNA

A DNA molecule is 140 base pairs long. It has 20% thymine. How many guanine bases are present in the molecule?

1. 64
2. 84
3. 32
4. 56

To separate repetitive DNA from bulk genomic DNA, which of the following method is used ?

1. Elution
2. Southern Blotting
3. Polymerase Chain Reaction
4. Density Gradient Centrifugation

A bacterium having radioactive thymidine in its DNA is allowed to multiply in a medium having non-radioactive thymidine for two generations. What percentage of bacteria will have radioactive thymidine in its DNA ?

1. 100
2. 50
3. 75
4. 25

Two plants whose DNA has been sequenced are

1. Rice and Wheat
2. Wheat and Maize
3. Maize and Barley
4. Rice and Arabidopsis

Which of the following is used to visualize DNA bands under UV light after gel electrophoresis?

1. Acetocarmine
2. Safranine
3. Ethidium Bromide
4. Potassium Iodide

Assertion (A): DNA Ligase is used to join DNA fragments. Reason (R): It catalyses the formation of glycosidic bonds between nucleotides.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation for Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not correct explanation for Assertion (A).
3. Assertion (A) is true, Reason (R) is false.
4. Assertion (A) is false, Reason (R) is true.

Which one of the following options is the work of Oswald Avery, Colin MacLeod and Maclyn McCarty?

1. The genetic material is a protein
2. They discovered that DNA alone could transform S-Bacteria to R-Bacteria
3. Proteases affected transformation
4. RNases affected transformation

Which one of the following combinations of base pair is present only in RNA?

1. Adenine and Thymine
2. Guanine and Cytosine
3. Uracil and Adenine
4. Thymine and Guanine

In the lac operon, which gene is responsible for the production of permease enzyme?

1. i gene
2. z gene
3. y gene
4. a gene

If a double-stranded DNA has 30% of cytosine, what will be the percentage of adenine in it?

1. 20%
2. 40%
3. 30%
4. 60%

Assertion (A): Eukaryotic mRNA requires post-transcription processing for formation of functional mRNA. Reason (R): Eukaryotic transcripts possess extra non-functional segments called introns.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

The smallest part of DNA molecule that can be changed by point mutation is:

1. Oligonucleotide
2. Codon
3. Gene
4. Nucleotide

Assertion (A): DNA cannot pass through cell membrane of a bacterial cell. Reason (R): DNA is a hydrophilic molecule.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): Repetitive sequences are stretches of DNA sequences that are thought to have no direct coding functions. Reason (R): They shed light on chromosome structure, dynamics and evolution.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Taylor and colleagues performed an experiment on which of the following organisms to provide proof for semi-conservative replication of DNA in chromosomes ?

1. Garden pea
2. Escherichia coli
3. Vicia faba
4. Drosophila

A gene having non-coding introns and coding exons is known as :

1. Pseudogene
2. Structural gene
3. Split gene
4. Oncogene

Choose the correct statements: (i) Polycistronic mRNA is generally found in eukaryotes. (ii) The RNA polymerase II transcribes precursor of mRNA, the hnRNA. (iii) The process of translation of mRNA begins when the mRNA encounters the large subunit of ribosomes. (iv) Stop codons do not have any tRNAs.

1. (i) and (ii)
2. (ii) and (iii)
3. (ii) and (iv)
4. (i), (ii) and (iv)

A DNA molecule is 160 base pairs long. It has 30% Guanine. How many Adenine bases are present in this DNA molecule?

1. 48
2. 64
3. 96
4. 192

Assertion (A): Repetitive sequences make up a very large portion of human genome. Reason (R): Repetitive sequences do not have direct coding functions in the genome.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Given below is the restriction site of a restriction endonuclease Pst I and the cleavage sites on a DNA molecule. 5 C — T – G – C – A — G 3 / 3 G — A – C – G – T — C 5. Choose the option that gives the correct resultant fragments.

1. 5 C – T – G C – A – G 3 / 3 G – A – C – G – T C 5
2. 5 C – T G – C – A – G 3 / 3 G – A – C – G T – C 5
3. 5 C – T – G – C A – G 3 / 3 G – A – C – G T – C 5
4. 5 C – T – G – C – A G 3 / 3 G A – C – G – T – C 5

Beads-on-string represent:

1. Linker DNA
2. Histone proteins
3. Nucleosomes
4. NHC proteins

The substrate used during DNA replication by the enzyme DNA-dependent DNA polymerase is:

1. Deoxyribonucleotide triphosphate
2. Deoxyribonucleoside triphosphate
3. Ribonucleotide triphosphate
4. Ribonucleoside triphosphate

Use the given information to select the amino acid attached to the 3' end of tRNA during the process of translation, if the coding strand of the structural gene being transcribed has the nucleotide sequence TAC. Codons for the amino acids: AUC - Isoleucine, AUG - Methionine, UAC - Tyrosine, GUA - Valine

1. Isoleucine
2. Methionine
3. Tyrosine
4. Valine

A nucleosome is composed of:

1. Histones and linker DNA
2. Histones and about 200 bp of DNA
3. NHC proteins and linker DNA
4. NHC proteins and about 200 bp of DNA

The simplest definition of a gene in eukaryotes is A unit of DNA that has information to mainly specify the synthesis of:

1. Single polypeptide chain and mRNA only
2. Many polypeptide chains and mRNA only
3. Single polypeptide chain and functional RNA only
4. Many polypeptide chains and functional RNA only

Use the given information to select the amino acid attached to the 3' end of tRNA during the process of translation, if the coding strand of the DNA is: Codons for the amino acids: UAU Tyrosine, AUG Methionine, AUA Isoleucine, AGU Serine

1. Isoleucine
2. Methionine
3. Tyrosine
4. Serine

Which of the following is the basic repeating unit of chromatin that consists of DNA wrapped around histone proteins?

1. Linker DNA
2. Histones
3. NHC proteins
4. 200 bp of proteins

Use the given information to select the amino acid attached to the 3' end of tRNA during the process of translation, if the coding strand of the DNA is TCCAGGGTTGATCGGCAAGCGAG. Codons for the amino acids: AGG = Arginine, AAG = Lysine, UCC = Serine, GGA = Glycine.

1. Arginine
2. Lysine
3. Serine
4. Glycine

The histone core in a nucleosome of chromatin thread is a/an :

1. pentamer
2. hexamer
3. heptomer
4. octamer

During the process of transcription, after binding to a promoter, RNA polymerase catalyses and makes the bases in the template strand of DNA available for base pairing, with the bases of:

1. Deoxyribonucleotide triphosphate
2. Deoxyribonucleoside triphosphate
3. Ribonucleotide triphosphate
4. Ribonucleoside triphosphate

What would happen if a gene encoding a polypeptide of 50 amino acids, 25th codon is UAU and is mutated to UAA?

1. A polypeptide of 49 amino acids will be formed.
2. A polypeptide of 25 amino acids will be formed.
3. A polypeptide of 24 amino acids will be formed.
4. A polypeptide of 50 amino acids will be formed.

The correct depiction of the centrifugation step of the experiment conducted by Alfred Hershey and Martha Chase on using radioactive labelled phages to prove that DNA is the genetic material is:

1. No Radioactive (35S) detected in cells + Radioactive (35S) detected in supernatant; Radioactive (32P) detected in cells + No Radioactivity detected in supernatant
2. Radioactive (35S) detected in cells + Radioactive (35S) detected in supernatant; No Radioactive (32P) detected in cells + No Radioactivity detected in supernatant
3. No Radioactive (35S) detected in cells + No Radioactivity detected in supernatant; Radioactive (32P) detected in cells + Radioactive (35S) detected in supernatant
4. Radioactive (35S) detected in cells + No Radioactivity detected in supernatant; No Radioactive (32P) detected in cells + Radioactive (35S) detected in supernatant

The region of chromatin that are actively transcribed are thought to be :

1. Heterochromatin
2. Euchromatin
3. Scaffold chromatin
4. Solenoid chromatin

The approach of sequencing the whole set of genome, including all the coding and non-coding sequences in HGP is :

1. Expressed Sequence Tags
2. Bioinformatics
3. Sequence Annotation
4. DNA Polymorphism

In lac-operon, the enzyme that is not needed for the metabolism of lactose is :

1. Transacetylase
2. Lactose permease
3. β-galactosidase
4. Lactose permease and transacetylase

In a DNA, percentage of thymine is 20. What is the percentage of Guanine ?

1. 20%
2. 30%
3. 40%
4. 60%

In E. coli, a DNA sequence that specifies where RNA polymerase will bind and initiate transcription of a gene is :

1. Start codon
2. Stop codon
3. Terminator
4. Promoter

The approach used in HGP of identifying all the genes that are expressed as RNA is referred to as :

1. SNPs
2. YACs
3. ESTs
4. BACs

If the DNA strand has the sequence 5'-TCCATAGCGTA-3', what will be the corresponding sequence of the transcribed mRNA ?

1. AGGUAUCGCAU
2. ACCUAUGCGAU
3. UGGTUTCGCAT
4. UCCAUAGCGUA

Removal of RNA polymerase-III from nucleoplasm of a eukaryotic cell will affect the transcription of which of the following ?

1. tRNA
2. hnRNA
3. mRNA
4. rRNA

The process of splicing in eukaryotes represents the dominance of the :

1. DNA world
2. RNA world
3. Protein world
4. Lipid world

Regulation of lac operon by repressor is referred to as :

1. Inducible regulation
2. Repressible regulation
3. Negative regulation
4. Positive regulation

SNPs in Human Genome Project refers to :

1. Polymorphism in repetitive sequences.
2. Single-base DNA differences.
3. Single changes in nucleotide of mRNA.
4. Loss or gain of a gene function.

Choose the correct option that indicates the enzyme, ribozyme in bacteria that acts as a catalyst.

1. 28S rRNA
2. 5·8S rRNA
3. 26S rRNA
4. 23S rRNA

Some of the important goals of HGP are given below. Choose the correct goal of HGP.

1. Identify approximately 20,000 – 30,000 genes in human DNA.
2. Determine the sequence of two billion chemical base pairs of human DNA.
3. Trace human history and disease associated sequences.
4. Address the ethical, legal and social issues that may arise from the project.

In a DNA, the percentage of thymine is 20. What is the percentage of guanine in it ?

1. 20%
2. 40%
3. 30%
4. 60%

Cistron is a segment of DNA coding for a :

1. Polypeptide only
2. mRNA only
3. Polypeptide, tRNA and rRNA
4. mRNA, tRNA and rRNA

If the sequence of bases in DNA is ATTCGATG, then the sequence of bases in the transcript will be :

1. CAUCGAAU
2. UAAGCUAC
3. AUUCGAUG
4. GUAGCUUA

In a translational unit UTRs are present at :

1. 5 end (after start codon) and 3 end (after stop codon).
2. 5 end (before start codon) and 3 end (before stop codon).
3. 5 end (after start codon) and 3 end (before stop codon).
4. 5 end (before start codon) and 3 end (after stop codon).

What are minisatellites?

1. 10-40 bp sized small sequences within the genes.
2. Short coding repetitive sequences region on the eukaryotic genome.
3. Short non-coding repetitive sequences forming a large portion of eukaryotic genome.
4. Regions of coding strand of DNA.

Assertion (A): Replication of DNA takes place in S phase of the cell cycle. Reason (R): DNA replication and cell division cycle should be highly coordinated.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): A piece of DNA inserted into an alien organism generally does not replicate, if not inserted into a chromosome. Reason (R): ori is where DNA replication is initiated.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Match the following genes of the lac operon listed in column 'A' with their respective products listed in column 'B'

1. a-(i), b-(iii), c-(ii), d-(iv)
2. a-(iii), b-(i), c-(ii), d-(iv)
3. a-(iii), b-(i), c-(iv), d-(ii)
4. a-(iii), b-(iv), c-(i), d-(ii)

If the sequence of nitrogen bases of the coding strand in a transcription unit is 5' – ATGAATG – 3', the sequence of bases in its RNA transcript would be

1. 5' – AUGAAUG – 3'
2. 5' – UACUUAC – 3'
3. 5' – CAUUCAU – 3'
4. 5' – GUAAGUA – 3'

How many base pairs will be there in 20 nucleosomes in a DNA double helix?

1. 4000
2. 40
3. 20
4. 2000

Assertion (A): The sugar-phosphate backbone of two chains in DNA double helix show anti-parallel polarity. Reason (R): The phosphor-diester bonds in one strand go from a 3' carbon of one nucleotide to a 5' carbon of adjacent nucleotide, whereas those in complementary strand go vice versa.

1. Both (A) and (R) are true and (R) is the correct explanation of (A).
2. Both (A) and (R) are true, but (R) is not the correct explanation of (A).
3. (A) is true, but (R) is false.
4. (A) is false, but (R) is true.

You know that there are twenty different types of naturally occurring amino acids and four different types of bases in the DNA. A combination of 3 such bases code for a specific amino acid. If instead there are 96 different amino acids and 12 different bases in the DNA, then the minimum number of combination of bases required to form a codon is :

1. 6
2. 8
3. 2
4. 4

Listed below are some amino acids and their corresponding mRNA codons: Amino acid mRNA codons - Phenylalanine UUU, Lysine AAG, Arginine CGA, Alanine GCA. Select the DNA sequence that would code for the following polypeptide sequence: Polypeptide - Alanine, Arginine, Lysine, Phenylalanine

1. CGT GCT TTC AAA
2. CGT GCT TTC TTT
3. CGU GCU UUC AAA
4. CGU GCU UUC TTT

In the double helical structure of DNA molecule, the strands are :

1. identical and complementary
2. identical and non-complementary
3. anti-parallel and complementary
4. anti-parallel and non-complementary

In a transcription unit the terminator is located towards the :

1. 3' end of the template strand
2. 5' end of the template strand
3. 5' end of the coding strand
4. 3' end of the coding strand

Assertion (A) : RNA is unstable and can mutate at a faster rate. Reason (R) : The presence of 2' OH group in every nucleotide of RNA makes it labile and easily degradable.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A)
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A)
3. Assertion (A) is true, but Reason (R) is false
4. Assertion (A) is false, but Reason (R) is true

A DNA fragment has 2000 nucleotides, out of which 140 are Adenine. How many bases does this DNA segment possess that have triple hydrogen bonds between them ?

1. 280
2. 860
3. 1720
4. 1860

In an experiment, E. coli is grown in a medium containing 14NH4Cl. (14N is the light isotope of Nitrogen) followed by growing it for six generations in a medium having heavy isotope of nitrogen (15N). After six generations, their DNA was extracted and subjected to CsCl density gradient centrifugation. Identify the correct density (Light/Hybrid/Heavy) and ratio of the bands of DNA in CsCl density gradient centrifugation.

1. Hybrid : Heavy, 1 : 16
2. Light : Heavy, 1 : 31
3. Hybrid : Heavy, 1 : 31
4. Light : Heavy, 1 : 05

Assertion (A) : Primary transcripts in eukaryotes are subjected to splicing to remove the introns. Reason (R) : Primary transcripts contain both exons and introns and the introns are non-functional in eukaryotes.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

A DNA fragment has 2500 nucleotides, out of which 240 are Guanine. How many bases having double hydrogen bonds between them does this DNA fragment possess ?

1. 480
2. 720
3. 1010
4. 2020

A DNA fragment has 3000 nucleotides, out of which 160 are Guanine. How many bases having double hydrogen bonds between them does this DNA fragment possess ?

1. 160
2. 320
3. 1340
4. 2680

Which was the last of the 24 human chromosome to be completely sequenced ?

1. Chromosome – 1
2. Chromosome – 11
3. Chromosome – 21
4. Chromosome – X

Assertion (A): Plasmids are autonomously replicating circular extra-chromosomal DNA. Reason (R): Plasmids are usually present in Eukaryotic cells.

1. Both (A) and (R) are true and (R) is the correct explanation of (A).
2. Both (A) and (R) are true and (R) is not the correct explanation of (A).
3. (A) is true, but (R) is false.
4. (A) is false, but (R) is true.

Assertion (A) : In an operon, the regulator and operator genes are not associated with the constitutive genes. Reason (R) : Constitutive genes need not be repressed.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): For sequencing, the total DNA from a cell is isolated and converted into random fragments. Reason (R): DNA is a very long polymer.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Given below is a list of steps Meselson and Stahl carried out in their experiment to prove that DNA replication is semi-conservative. Select the option that gives the correct sequence of steps followed by them. (i) Bacteria transferred to a N14 medium and sampled every 20 minutes. (ii) All bacteria contain hybrid DNA (N14 DNA and N15 DNA). (iii) Bacteria grown in N15 medium for many generations. (iv) All bacteria contain N15 DNA. (v) Bacteria contain either all N14 DNA or all hybrid DNA.

1. (ii) → (iv) → (iii) → (i) → (v)
2. (i) → (ii) → (v) → (iv) → (iii)
3. (iii) → (iv) → (i) → (ii) → (v)
4. (iv) → (iii) → (ii) → (v) → (i)

DNA profiles of the child and three individuals 1, 2 and 3 who claim to be the parents of the child are given below. Select the option that shows the correct actual parent/parents of the child.

1. Individual 1 and 3
2. Individual 1 and 2
3. Individual 2 and 3
4. Individual 1 is the only parent of the child amongst 1, 2 and 3

Identify the element used by Hershey and Chase to label the protein in their experiment, from the following options:

1. P32
2. S32
3. S35
4. P35

Assertion (A): For DNA sequencing, the total DNA from a cell is isolated and converted into random fragments of relatively smaller sizes. Reason (R): Human genome is said to have approximately 3 × 109 bp and the total estimated cost for sequencing is very high.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

(b) (i) Differentiate between a DNA and RNA nucleotide. (1 mark) (ii) Name the two types of bonds present within a single nucleotide. (1 mark)

Explain the two major approaches used while sequencing the total DNA from a cell.

(a) (i) Given below is the schematic representation of the process of electrophoresis. Identify the alphabets representing the: (I) Anode end, and (II) Lightest/Smallest DNA in matrix. (ii) What is Agarose gel and why is it used in this process?

One of the salient features of the genetic code is that it is nearly universal from bacteria to humans. Mention two exceptions to this rule. Why are some codes said to be degenerates?

Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames. Frame 1: 5' CUCGCUUGCCGAUCAAGGGUUA 3' and Frame 2: 5' GUGGCACUCAGUCCUUAAUGGCG 3'. How many amino acids will be specified in case (a) and case (b) on translation? Justify your answer.

Assume that the given mRNA (start site is not depicted) is theoretically translated in two reading frames. Frame 1: 5' CUCGCUUGCCGAUCAAGGGUUA 3' Frame 2: 5' GUGGCACUCAGUCCUUAAUGGCG 3' How many amino acids will be specified in case (a) and case (b) on translation? Justify your answer.

How many amino acids will be specified in case (a) and case (b) on translation? Justify your answer. Frame 1: 5' CUCGCUUGCCGAUCAAGGGUUA 3' Frame 2: 5' GUGGCACUCAGUCCUUAAUGGCG 3'

If the base adenine constitutes 31% of an isolated DNA fragment, then write what will be the expected percentage of the base cytosine in it. Explain how did you arrive at the answer given.

Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and answer the questions that follow: mRNA 5' UCAUUACCACGAUUCUUUAAAAGA 3' (a) How many amino acids will be formed from the given codons, if substitution of U by C takes place at the 5th codon ? Explain your answer. (b) Write the number of amino acids that would be in the polypeptide synthesised by a similar mRNA as above, where in the fourth

Consider the given data of a hypothetical small portion of mRNA that codes for a functional polypeptide chain and answer the questions that follow : mRNA 5' UCAUUACCACGAUUCUUUAAAAGA 3' (a) How many amino acids will be formed from the given codons, if substitution of U by C takes place at the 5th codon ? Explain your answer. (b) Write the number of amino acids that would be in the polypeptide synthesised by a similar mRNA as above, where in the fourth codon if U is replaced by C.

(a) What is a genetic code ? (b) Why did scientists feel the need to propose a genetic code ? (c) Genetic code is said to be 'Universal'. Why ?

What is a genetic code? Why did scientists feel the need to propose a genetic code? Genetic code is said to be 'Universal'. Why?

(a) State the dual role of deoxyribonucleoside triphosphates during DNA replication. (b) In which phase of the cell cycle does replication of DNA occur in eukaryotes? What would happen if cell division is not followed after DNA replication?

Describe the process of translation in protein synthesis.

(a) What is meant by translation in protein synthesis? (b) Explain charging of tRNA (aminoacylation of tRNA) and mention its importance in the process of translation.

(a) Construct a complete transcription unit with promoter and terminator on the basis of the hypothetical coding strand given below: A T G C A T G C A T A G (b) Write the RNA strand transcribed from the above transcription unit along with its polarity.

Draw a labelled diagram of a 'replicating fork' showing the polarity. Why does DNA replication occur within such 'fork'?

Explain how the addition of lactose in the medium regulates the switching on of the lac operon in bacteria.

oligopeptide with the amino acids, Lysine - Serine - Proline - Tyrosine. (a) Write the codons in correct sequence for the four amino acids. (b) If first adenine in DNA is substituted by guanine, what will be the sequence of amino acids in the new oligopeptide? (c) Write the anticodons for these amino acids.

The base sequence in one of the strands of DNA is: (a) Give the base sequence of its complementary strand. (b) How are these base pairs held together in DNA molecule? (c) Explain the base complementarity rule. Name the scientist who framed this rule.

(a) Why does DNA replication occur within a replication fork and not in its entire length simultaneously? (b) "DNA replication is continuous and discontinuous on the two strands within the replication fork." Explain with the help of a schematic representation.

Explain the processing of heterogeneous nuclear RNA (hnRNA) into a fully functional mRNA in eukaryotes. Where does this processing occur in the cell?

(a) Name and write two characteristics of the type of DNA that forms the basis of DNA fingerprinting technique. (b) Mention any two applications of this technique.

(a) Explain the process by which amino acid gets attached to the tRNA molecule during translation process. (b) How does the translation process get terminated ? (c) Expand UTR. Where are they located ?

(a) (i) How many types of RNA polymerases are there in a eukaryote cell? Mention which one of them transcribes hnRNA. (ii) Write the changes that hnRNA undergoes before it leaves the nucleus as mRNA. OR (b) The length of DNA in any cell is far greater than the dimension of its nucleus. Explain how this enormous DNA is packaged in a eukaryotic cell.

(a) (i) How many types of RNA polymerases are there in an eukaryote cell ? Mention which one of them transcribes hnRNA. (ii) Write the changes that hnRNA undergoes before it leaves the nucleus as mRNA. OR (b) The length of DNA in any cell is far greater than the dimension of its nucleus. Explain how this enormous DNA is packaged in a eukaryotic cell.

(a) (i) Watson and Crick's discovery of double helical structure was based on which two findings. Also mention the name of the scientists associated with these findings. (2 marks) (ii) Write down the salient features of double helix structure of DNA (any three points). (3 marks)

(a) (i) Watson and Crick's discovery of double helical structure was based on which two findings. Also mention the name of the scientists associated with these findings. (2 marks) (ii) Write down the salient features of double helix structure of DNA (any three points). (3 marks) OR (b) Given below is a stretch of DNA showing the coding strand of structural gene of transcription unit. 5' - ATG ACC GTA TTT TCT GTA GTG CCC GTA CTT CAG GCA TTA 3' (i) Write the corresponding template strand and m-RNA strand that will be transcribed along with its polarity. (2 marks) (ii) If GUA of transcribed mRNA is an intron, then depict the sequence involved in formation of mRNA / mature / processed hnRNA strand: (1) In a bacterium (1 mark) (2) In humans (1 mark) (iii) How many amino acids the resulting polypeptide will have after the process of translation in humans? (1 mark)

Describe how the lac operon operates both in the presence and absence of an inducer in E.coli.

(a) (i) Describe the series of experiments conducted by Frederick Griffith. Comment on the significance of the result obtained. (ii) State the contribution of Avery, MacLeod and McCarty.

(a) The following questions are based on the classic experiment conducted by Hershey and Chase. (i) Why were bacteriophages chosen by the scientists ? (ii) Name the radioactive isotopes used and state the reason for using them. (iii) Describe the steps of the experiment. (iv) Why is this experiment considered a major breakthrough in the field of molecular biology ?

(b)(i) Enlist any four prime goals of the Human Genome Project (HGP). (ii) List the two methodologies which were involved in the human genome project. Mention how they were used. (iii) Expand 'YAC' and mention what it was used for.

Write the features a molecule should have to act as a genetic material. In the light of the above features, evaluate and justify the suitability of the molecule that is preferred as an ideal genetic material.

(a) Stability, as one of the properties of genetic material, was very evident in one of the very early experiments in genetics. Name the scientist and describe his experiment. State the conclusion he arrived at. OR (b) A tall pea plant bearing violet flowers with unknown genotype is given. Find the genotype by working out different crosses only by selfing the plants. Write the genotypic and phenotypic ratios of each cross shown by you.

(b) (i) Draw a schematic, self-explanatory labelled diagram of lac operon in switched on condition. (ii) Why is regulation of lac operon referred to as negative regulation ?

(b) Explain the experiment performed by Griffith for the search of genetic material and write the conclusion he arrived at. How did Avery, MacLeod and McCarty establish the biochemical nature of the genetic material identified by Griffith?

(a) (i) Why did they use radioactive sulphur 35S and radioactive phosphorus 32P in their respective culture media for growing E. coli population which subsequently were infected by bacteriophage? (ii) State the purpose of their using the following: (1) Blender (2) Centrifuge (iii) Write the observations they made during the course of their experiment. (iv) Based on the results, write the conclusion they arrived at the end of their experiment.

Answer the following questions that are based on Hershey and Chase experiment using E. coli and bacteriophage.

(b) (i) Explain the role of lac repressor genes of lac operon. (ii) lac operon is called an inducible operon. State reason.

(a) Meselson and Stahl carried out an experiment to prove the nature of DNA replication. Recall the experiment and answer the following questions. (i) Which two types of nitrogen were used by them in their experiment and why? (ii) Why did they take samples of E. coli at definite time intervals for their observation? (iii) State the role of caesium chloride density gradient in their experiment. (iv) Write the conclusions they arrived at.

(a) Protein synthesis requires the services of all three types of RNAs, namely t-RNA, m-RNA and r-RNA. Explain the role of each of them during the process of protein synthesis in prokaryotes.

(a) (i) Draw a labelled diagram of a replication fork in a prokaryote indicating the process of DNA replication. (ii) Differentiate between the two newly synthesised DNA strands within the fork. (iii) Name the enzymes involved in the process of DNA replication. (iv) Name the eukaryote where the semi-conservative mode of replication was experimentally proved.

(a) Protein synthesis requires the services of all three types of RNAs, namely t-RNA, m-RNA and r-RNA. Explain the role of each of them during the process of protein synthesis in prokaryotes. OR (b) A homozygous tall pea plant with green seeds is crossed with a homozygous dwarf pea plant with yellow seeds. (i) Write the possible phenotype and genotype of F1 generation. (ii) State the laws of Mendel that are proved true by the F1 generation. (iii) Mention the F2 phenotypic ratio along with their possible phenotypes. (iv) Write the genotypes of the male and female gametes produced by F1 progeny.

Assertion (A) : Hardy-Weinberg principle says that allele frequencies in a population are stable. Reason (R) : Hardy-Weinberg principle is applicable only when genetic drift does not occur.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

The idea of use and disuse of organs for evolution of organism was proposed by

1. Charles Darwin
2. Thomas Malthus
3. Hugo De Vries
4. Lamarck

Assertion (A): The population of melanized moths increased in industrial areas after Industrial Revolution. Reason (R): In Industrial environment lichen covered trees were replaced by soot-covered trees offering better camouflage to dark coloured moths.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation for Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation for Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): When we see stars, we are apparently peeping into the past. Reason (R): What we see today is an object whose emitted light started its journey millions of years back reaching our eyes now.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation for Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation for Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Which one of the following evidences does not support Darwin's theory of natural selection?

1. Branching Descent
2. Small & directional variations
3. Appearance of new traits by mutations
4. Survival of the fittest

Assertion (A): Fossils provide direct evidence for evolution. Reason (R): Fossils help to trace evolutionary relationships among organisms over time.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation for Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation for Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

What conclusion can be drawn if the forelimbs of an aquatic animal and a terrestrial animal have similar anatomical structure ?

1. Live in same habitat
2. Share common ancestors
3. Forelimbs perform same functions
4. Forelimbs are analogous

Assertion (A): Under a particular set of selection pressure, organisms evolve towards the most efficient reproductive strategy. Reason (R): Populations evolve to maximise their reproductive fitness in the habitat where they live.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation for Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not correct explanation for Assertion (A).
3. Assertion (A) is true, Reason (R) is false.
4. Assertion (A) is false, Reason (R) is true.

Which one of the following reasons is correct for divergent evolution to happen?

1. Adaptation to different needs
2. Predator-Prey inter-relationship
3. Selection of similar habitat
4. Different structures evolving for the same function

Appearance of antibiotic-resistant bacteria is an example of evolution due to:

1. Adaptive radiation
2. Divergent evolution
3. Artificial selection
4. Anthropogenic action

Identify the statements that correctly describe Darwin's Theory of Evolution. (i) Overproduction of organisms leads to competition. (ii) Variation is inherited and causes evolution. (iii) Acquired characters are inherited. (iv) Survival depends on favourable traits. (v) New species arise due to accumulation of favourable variations. Choose the correct option.

1. (i), (ii), (iv) and (v) are correct
2. (ii), (iii) and (iv) are correct
3. All are correct
4. Only (i) and (iv) are correct

Name the extinct ancestor of humans who ate only fruits and hunted with stone weapons.

1. Ramapithecus
2. Australopithecus
3. Dryopithecus
4. Homo erectus

Thorns of Bougainvillea and tendrils of Cucurbita are examples of:

1. Analogous organs
2. Convergent evolution
3. Homologous organs
4. Vestigial organs

Arrange the following in the correct sequence of their evolution and select the correct option: (i) Seaweed (ii) Invertebrates (iii) Jawless fish

1. (i), (ii), (iii)
2. (i), (iii), (ii)
3. (ii), (iii), (i)
4. (ii), (i), (iii)

Select the odd option in the context of convergent evolution.

1. Eyes of Octopus and Mammals
2. Flippers of Penguins and Dolphins
3. Flying Squirrel and Flying Phalanger
4. Thorns of Bougainvillea and Tendrils of Cucurbita

Which type of selection is industrial melanism observed in moth, Biston betularia?

1. Stabilising
2. Directional
3. Disruptive
4. Artificial

If a natural population with 50 individuals is in Hardy-Weinberg equilibrium for a gene with two alleles A and a, with the gene frequency of allele A of 0·6, the genotype frequency of Aa will be :

1. 0·16
2. 0·36
3. 0·24
4. 0·48

If a natural population of 60 individuals is in Hardy-Weinberg equilibrium for a gene with two alleles B and b, with the gene frequency of allele B of 0·7, the genotype frequency of Bb will be :

1. 0·21
2. 0·42
3. 0·48
4. 0·56

If a natural population with 200 individuals is in Hardy-Weinberg equilibrium for a gene with two alleles A and a, with the gene frequency of allele A of 0·8, the genotype frequency of Aa will be :

1. 0·8
2. 0·16
3. 0·32
4. 0·64

About 15 mya during human evolution, the primates which used to walk like gorillas and chimpanzees were:

1. Australopithecine and Neanderthal
2. Dryopithecus and Ramapithecus
3. Homo erectus and Homo sapiens
4. Homo habilis and Homo erectus

The primates that probably lived in East Africa grasslands about two mya were:

1. Dryopithecus
2. Ramapithecus
3. Australopithecines
4. Neanderthal

The first human-like hominid evolved during human evolution is supposed to be:

1. Neanderthal man
2. Homo habilis
3. Homo erectus
4. Homo sapiens

Which of the following combinations is a correct example of convergent evolution in Australian marsupials and Placental mammals?

1. Lemur and Spotted cuscus
2. Tasmanian tiger cat and Anteater
3. Bobcat and Lemur
4. Numbat and Anteater

Which of the following combinations is a correct example of convergent evolution in Placental mammals and Australian marsupials ?

1. Anteater and Lemur
2. Numbat and Bobcat
3. Tasmanian tiger cat and Anteater
4. Lemur and Spotted cuscus

In his observations of small black birds in the Galapagos Islands, Darwin found that all the finches arose from the original ancestor :

1. Insect-eating finches
2. Seed-eating finches
3. Cactus-eating finches
4. Fruit-eating finches

The animals that evolved into the first amphibians during evolutionary history were :

1. Archaeopteryx
2. Salamander
3. Coelacanth
4. Lobefins

Land reptiles which went back into water about 200 mya to evolve into fish-like reptiles were :

1. Ichthyosaurus
2. Tyrannosaurus
3. Stegosaurus
4. Brachiosaurus

A population is in genetic equilibrium/Hardy-Weinberg equilibrium for a gene with two alleles (dominant allele and recessive allele). If the frequency of allele a is 0.6, then the frequency of genotype Aa is :

1. 0.21
2. 0.42
3. 0.48
4. 0.32

A population is in genetic equilibrium/Hardy-Weinberg equilibrium for a gene with two alleles (dominant and recessive). If the frequency of the recessive allele is 0.6, then the frequency of genotype Aa is:

1. 0.21
2. 0.42
3. 0.48
4. 0.32

Single step large mutation leading to speciation is also called

1. founder effect
2. saltation
3. branching descent
4. natural selection

The scientist who proposed that embryos of all vertebrates including humans develop a row of vestigial gill slits behind the head but it is a functional organ only in fish and replaced by lungs in all other vertebrates

1. Darwin
2. Lamarck
3. Ernst Haeckel
4. Mendel

Assertion (A) : Gene flow increases genetic variations. Reason (R) : The random introduction of new alleles into a recipient population and their removal from donor population affects allele frequency.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Which one of the following statements is not true ?

1. Flippers of whales and dolphins are homologous organs
2. Homologous organs have similar anatomical structure, but perform different functions
3. Homology indicates common ancestry
4. Homologous structures are a result of convergent evolution

Homologous organs indicate:

1. Convergent Evolution
2. Divergent Evolution
3. Adaptive Radiation
4. Natural Selection

During the 1850s in the pre-industrialisation era in England, the expected effect of natural selection on the number of dark-winged moths as compared to white-winged moths was :

1. more in number
2. less in number
3. both were equal in number
4. both were less in number

S.L. Miller in 1953, to support the theory of chemical evolution, created conditions in the closed flask that included :

1. CH3, O2, NH3, H2O vapour at 1800C
2. CH4, H2, NH3, H2O vapour at 800C
3. CH4, CO2, H2, H2O vapour at 1800C
4. CH4, NH4, SO2, H2O vapour at 800C

After the 1850s in the post-industrialization era in England, the expected effect of natural selection on the number of white-winged moths as compared to the dark-winged moths was :

1. Less in number
2. More in number
3. Both were less in number
4. Both were more in number

The origin of life according to the early Greek philosophers was transfer of unit of life from outer space to the different planets in the form of :

1. seeds
2. spores
3. gemmules
4. gametes

After the 1850s in the post-industrialisation era in England, the expected effect of natural selection on the number of white-winged moths as compared to the dark-winged moths was :

1. Less in number
2. More in number
3. Both were less in number
4. Both were more in number

Who proposed the mutation theory in favour of organic evolution ?

1. Weisman
2. Louis Pasteur
3. Darwin
4. Hugo de Vries

Hugo de Vries proposed the mutation theory of organic evolution after his experiments on

1. Garden pea
2. Evening primrose
3. Fruit fly
4. Four O' clock plant

Select the option that gives the correct description of the process of Natural Selection with respect to the length of the neck of giraffe.

1. Stabilising selection as giraffes with longer neck lengths are selected further.
2. Disruptive selection as giraffes with smaller and longer neck lengths are selected.
3. Directional selection as giraffes with longer neck lengths are selected.
4. Stabilising selection as giraffes with medium neck lengths are selected.

Assertion (A): Darwin showed how even a slow growing animal like an elephant could reach enormous numbers. Reason (R): When resources in the habitat are unlimited, each species has the ability to realise its innate potential fully.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): The number of white winged moths decreased drastically after industrialisation in England. Reason (R): Effects of industrialisation were more marked in rural areas of England.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A) : Homo sapiens have evolved from chimpanzee-like ancestors. Reason (R) : There is no difference between the two in the amino acid sequence of the protein Cytochrome-C.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A) : The Monarch butterfly is highly distasteful to the predators. Reason (R) : The butterfly has a very rough skin which is not palatable.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Which one of the following was not present during the Mesozoic Era of the geological time scale?

1. Ferns
2. Horsetails
3. Ginkgos
4. Bryophytes

(b) The allele for brown eyes (B) is dominant over blue eyes (b). In a population, 36% of individuals have blue eyes. Assuming Hardy-Weinberg equilibrium, calculate: (i) Frequency of allele B (ii) Percentage of heterozygous individuals (iii) Percentage of individuals that are homozygous dominant (Working to be shown)

(a) (i) Mention any two characteristics of Neanderthal man that lived near East and Central Asia. (ii) Identify the following hominids with respect to human evolution: (I) Brain capacity 900 cc, probably ate meat. (II) First human-like with brain capacity 650 – 800 cc.

(a) (i) Rearrange the following in correct order of their appearance on Earth between 2 million years and 40,000 years ago: Homo Neanderthalensis, Australopithecus, Homo erectus, Homo habilis. (ii) Which one of the above: (I) had the largest brain size? (II) ate fruits?

A few stages and their respective time period in the evolutionary history of human beings are mentioned in the flowchart given below: 15 mya - Primates walking like gorillas and chimpanzees existed. (a) 3-4 mya - Man-like primates walked in Eastern Africa. Fossils of their bones were discovered. (b) 2 mya - This ancestor lived in the East African grasslands and ate fruits. (c) 1.5 mya - This hominid had a brain size of 900 cc and probably ate meat. (d) Based on the above information, answer the following questions: (a) Name one primate about 15 mya. (b) Name one place where fossils of primates were discovered in Eastern Africa. (c) Name the ancestor that lived in the East African grasslands about 2 mya. (d) Name the hominid that was found around 1.5 mya.

A few stages and their respective time period in the evolutionary history of human beings are mentioned in the flowchart given below: 15 mya - Primates walking like gorillas and chimpanzees existed. 3-4 mya - Man-like primates walked in Eastern Africa. Fossils of their bones were discovered. 2 mya - This ancestor lived in the East African grasslands and ate fruits. 1.5 mya - This hominid had a brain size of 900 cc and probably ate meat. Based on the above information, answer the following questions: (a) Name one primate about 15 mya. (b) Name one place where fossils of primates were discovered in Eastern Africa. (c) Name the ancestor that lived in the East African grasslands about 2 mya. (d) Name the hominid that was found around 1.5 mya.

Given below is an illustration of the experiment performed by Louis Pasteur. Explain the experiment and its conclusion.

(a) How is Hardy-Weinberg expression (p² + 2pq + q²) = 1 derived? (2 marks) (b) List any two factors that disturb the genetic equilibrium. (1 mark)

How is Hardy-Weinberg expression (p² + 2pq + q²) = 1 derived? List any two factors that disturb the genetic equilibrium.

S.L. Miller conducted an experiment in 1953 to simulate the conditions of early earth in a laboratory setup. Answer the following questions based on the experiment : (a) What was the aim of his experiment ? (b) Name the gases used and the source of energy.

(a) Compare homologous and analogous organs by giving any one point of difference. (b) Mention the type of evolution each represents and give one example of each from plants and animals.

Explain the three different ways in which natural selection operates. Explain with the help of graphs.

Define adaptive radiation. How did Darwin explain adaptive radiation?

(a) Explain the significance of the experiment carried out by S.L. Miller. Name the scientists whose hypothesis prompted him to carry out this experiment. (b) How does meteorite analysis favour this hypothesis ?

Explain the significance of the experiment carried out by S.L. Miller. Name the scientists whose hypothesis prompted him to carry out this experiment.

(a) List the specific features of Darwin's concept of natural selection. (b) Microbes have proved to be suitable examples to study evolution by natural selection. Justify giving reasons.

(a) Name the two primate ancestors of the present day humans, who existed approximately about 15 million years ago. (b) According to geological records, when and where did Australopithecines live? (c) Give two differences between Homo habilis and Homo erectus.

(a) Darwin's theory of natural selection is widely accepted in general, but modern biologists have identified some limitations. Mention the limitations identified. (b) Name and state the most accepted theory of evolution in modern times. (c) Mention any two ways the limitations of Darwin's theory of evolution are explained in modern biology.

(a) Natural selection theory is widely accepted but some limitations have been identified by modern biologists. Mention the limitations identified. (b) Name and state the most accepted theory of evolution in modern times. (c) Mention any two ways the limitations identified in Darwin's theory of evolution are explained in modern biology.

(a) Darwin's theory of natural selection has been widely accepted, but modern biologists have identified some limitations. Mention the limitations identified. (b) Name and state the most accepted theory of evolution in modern times. (c) Mention any two ways by which the limitations of Darwin's theory of evolution are explained in modern biology.

(a) (i) Describe the phenomenon of adaptive radiation as explained by Darwin. (ii) Is human evolution an example of adaptive radiation? Give reason in support of your answer.

Some statements regarding drugs and alcohol are given below : (i) Adolescents are more vulnerable to peer pressure. (ii) Drug addiction leads to increased tolerance level of the receptors present in our body. (iii) Alcohol affects the central nervous system. (iv) Excessive use of drugs helps to increase energy. (v) Anabolic steroids decrease aggressiveness. Choose the option with correct statement(s).

1. Statements (i), (iv) and (v) are correct
2. Statements (i), (ii) and (iii) are correct
3. Only statements (i) and (v) are correct
4. Only statement (iii) is correct

Which of the following is not a component of immune system?

1. Lymphocytes
2. Plasma Proteins
3. Red Blood Cells
4. Bone Marrow

Interferons are most effective in making non-infected cells resistant against the spread of which of the following diseases?

1. Malaria
2. Ascariasis
3. Pneumonia
4. Cancer

What is the role of histamine released by mast cells ?

1. Lowers blood pressure
2. Causes allergic symptoms
3. Stimulates antibody formation
4. Destroys pathogens

Antivenom injection is an example of

1. Natural Active Immunity
2. Artificial Active Immunity
3. Natural Passive Immunity
4. Artificial Passive Immunity

If any organ fails to function satisfactorily, transplantation is the only remedy to enable the patient to live a normal life. All of the following are true w.r.t. transplantation except -

1. Tissue matching is essential before undertaking any graft.
2. T-lymphocytes play an important role in graft rejection.
3. Patient takes immuno-suppressants for first few weeks only after transplantation.
4. Blood group matching is important before transplantation.

Which of the following is not a symptom of Ascariasis?

1. Intestinal blockage
2. Muscular pain and fever
3. Anaemia
4. Skin ulcers

Consider the following statements and choose the correct option : Statement I : Using vaccination and immunization programmes, we have been able to eradicate smallpox. Statement II : Vaccines are available for diphtheria and polio.

1. Both Statements I and II are false.
2. Both Statements I and II are true.
3. Only Statement I is true.
4. Only Statement II is true.

Which cells are responsible for producing antibodies in a human body ?

1. Macrophages
2. Helper T-Lymphocytes
3. Cytotoxic T-Cells
4. B-Lymphocytes

Which of the following is a carrier for the disease Amoebiasis ?

1. Culex mosquito
2. Female Anopheles mosquito
3. Snail
4. Housefly

Nicotine affects blood pressure and heart rate due to release of certain adrenal hormones. Following are some of the adrenal hormones: (i) Adrenaline (ii) Cortisol (iii) Noradrenaline (iv) Aldosterone. Select the correct option:

1. (i) and (ii)
2. (i) and (iv)
3. (ii) and (iii)
4. (i) and (iii)

Internal bleeding, muscular pain, blockage of the intestinal passage and anaemia are some of the symptoms caused due to infection by:

1. Ascaris
2. Wuchereria
3. Plasmodium
4. Trichophyton

S is the stimulant of central nervous system and interferes with the transport of T, a neurotransmitter. Identify S and T and choose the correct option.

1. S – Cocaine, T – Dopamine
2. S – Heroin, T – Acetylcholine
3. S – Heroin, T – Dopamine
4. S – Cocaine, T – Acetylcholine

A doctor identifies symptoms of nasal congestion, headache, sore throat, hoarseness and cough in a patient. The conclusion is that the patient is infected by a pathogen:

1. Plasmodium
2. Adenovirus
3. Salmonella
4. Rhinovirus

In which of the following human diseases does the body's defence mechanism attack self-cells?

1. Thalassemia
2. Phenylketonuria
3. Filariasis
4. Rheumatoid arthritis

The technique for the early detection of a disease based on the principle of antigen-antibody interaction is:

1. RNAi
2. EST
3. PCR
4. ELISA

Assertion (A): A person infected with malaria suffers from chill and high fever, recurring every three or four days. Reason (R): The parasite attacks the RBC resulting in their rupture and release of haemozoin.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

The type of antibodies produced during an immune response to allergens as dust and pollen grains in a person is:

1. IgE
2. IgA
3. IgG
4. IgD

Early detection of HIV in suspected AIDS patients can be done using the diagnostic technique of:

1. ELISA
2. PCR
3. EST
4. RNAi

Assertion (A): A person infected with malaria suffers from chill and high fever, recurring every three or four days. Reason (R): The parasite attacks the RBC resulting in their rupture and release of haemozoin. Select the correct answer to these questions from the codes (A) Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A). (B) Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A). (C) Assertion (A) is true, but Reason (R) is false. (D) Assertion (A) is false, but Reason (R) is true.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A)
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A)
3. Assertion (A) is true, but Reason (R) is false
4. Assertion (A) is false, but Reason (R) is true

Allergy in humans is a result of release of the following chemicals from the mast cells:

1. Histamine and Serotonin
2. Adrenaline and Acetylcholine
3. Dopamine and Nor-adrenalin
4. Endorphins and GABA

Assertion (A): A person infected with malaria suffers from chill and high fever, recurring every three or four days. Reason (R): The parasite attacks the RBC resulting in their rupture and release of haemozoin. Select the correct answer.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

The lobed organ located near the heart and beneath the breast bone in humans is :

1. Liver
2. Spleen
3. Thymus
4. Lungs

Assertion (A): Lymphocytes arise from bone marrow and present in the blood and lymph and serve as natural killer cells. Reason (R): Lymphocytes migrate to thymus, where they develop into T-cells and begin to mature.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

The large bean-shaped organ acting as a filter of the blood in humans is :

1. Liver
2. Thymus
3. Spleen
4. Heart

A characteristic property that distinguishes a malignant tumor from a benign tumor is :

1. Metamorphosis
2. Metastasis
3. Metabolism
4. Metagenesis

Assertion (A) : In humans, filariasis is characteried by inflammation in the lower limbs. Reason (R) : Filarial worm usually lives in the lymphatic vessels of the lower limbs.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Human Immunodeficiency Virus is a member of the group of viruses known as :

1. Adenovirus
2. Retrovirus
3. Rhinovirus
4. Nucleopolyhedrovirus

The lymphoid organ located within the lining of respiratory, digestive and urinogenital tract is :

1. GEAC
2. MALT
3. NACO
4. RCH

Assertion (A) : An antibody is a protein molecule made by the lymphocytes. Reason (R) : An antibody binds to a specific foreign antigen and neutralizes its odd effects.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

The following information is about drugs and tobacco. Select the correct statement from the options given below.

1. Cocaine is given to patients after surgery as it stimulates recovery.
2. Chewing tobacco lowers blood pressure and heart rate.
3. Barbiturates when given to criminals makes them tell the truth.
4. Morphine is often given to persons who have undergone surgery as a painkiller.

Which one of the following immune system components does not correctly match with its respective role?

1. Interferons - Secreted by virus-infected cells and protect non-infected cells from further viral infection.
2. Macrophages - Mucus-secreting cells that trap microbes entering into the body.
3. B-Lymphocytes - Produce antibodies in response to pathogens into blood to fight with them.
4. IgA - Present in colostrum in early days of lactation to protect infants from diseases.

Study the items of columns I and II where drugs and their effects are given and match them correctly. Column-I: a. Heroin b. Marijuana c. Cocaine d. Morphine Column-II: i. Affects cardiovascular system ii. Slows down body functions iii. Painkiller iv. Interferes with transport of dopamine Choose the correct answer from the options given below:

1. a-iv, b-iii, c-ii, d-i
2. a-iii, b-iv, c-i, d-ii
3. a-ii, b-i, c-iv, d-iii
4. a-i, b-ii, c-iii, d-iv

Assertion (A) : The chronic use of alcohol by a person leads to cirrhosis. Reason (R) : Alcohol addiction at times becomes the cause of mental and financial distress to the entire family of the addicted person.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Interferons are proteins secreted by

1. RBC
2. WBC
3. Bacteria infected cell
4. Virus infected cell

Assertion (A): AIDS is a syndrome caused by HIV. Reason (R): HIV is a virus that damages the immune system with DNA as its genetic material.

1. Both (A) and (R) are true and (R) is the correct explanation of (A).
2. Both (A) and (R) are true, but (R) is not the correct explanation of (A).
3. (A) is true, but (R) is false.
4. (A) is false, but (R) is true.

In which of the following conditions/diseases is there a substantial increase in the activity of mast cells observed in the human body ?

1. Typhoid
2. Allergy
3. Ascariasis
4. AIDS

During an allergic reaction, the binding of antigen to IgE antibodies initiates release of :

1. Interferon
2. Histamine
3. Heparin
4. Acetylamine

The vector for dengue fever is :

1. Female Aedes mosquito
2. Female Anopheles mosquito
3. Male Aedes mosquito
4. Female Culex mosquito

Assertion (A) : Virus-infected cells produce interferons. Reason (R) : Interferons can cause inflammation of virus-infected cells.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A)
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A)
3. Assertion (A) is true, but Reason (R) is false
4. Assertion (A) is false, but Reason (R) is true

Allergic reactions are countered by the administration of:

1. Glucagon
2. Insulin
3. Antihistamine
4. Oxytocin

Which disease is the patient suffering from who is showing symptoms such as sustained high fever (39C to 40C), stomach pain, constipation, headache, loss of appetite and weakness ?

1. Pneumonia
2. Malaria
3. Typhoid
4. Amoebiasis

A patient is suffering from fever, chills, cough, headache and bluish finger nails and lips. These symptoms are of the disease :

1. Malaria
2. Typhoid
3. Common cold
4. Pneumonia

A patient is suffering from the infection of the alveoli of lungs and is showing the symptoms of fever, chills, cough, headache and bluish coloured lips and finger nails. The patient was diagnosed to be suffering from the infection of :

1. Epidermophyton
2. Entamoeba histolytica
3. Haemophilus influenzae
4. Salmonella typhi

ELISA technique is based on the principle of

1. DNA replication
2. antigen-antibody interaction
3. pathogen – antigen interaction
4. antigen – protein interaction

Select the options which is/are incorrect statement(s) with respect to T-lymphocytes in the human body. (i) They are a type of white blood cells. (ii) They are produced in bone marrow. (iii) They remain active at all times in the body. (iv) They mature in the bone marrow.

1. (i) and (iv) only
2. (iii) only
3. (iv) only
4. (iii) and (iv) only

Assertion (A): More and more children in metro cities of India suffer from allergies and asthma due to sensitivity to the environment. Reason (R): Modern day lifestyle and a protected environment in early life has resulted in lowering the immunity.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): The Covid-19 virus has a shorter life-span and evolves into new strains at a fast speed. Reason (R): RNA being unstable, mutates at a faster rate.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): Mary Mallon continued to spread typhoid for many years. Reason (R): Salmonella typhi generally enters the small intestine through food and water contaminated with it.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Differentiate between opioids and cannabinoids on the basis of their (a) Receptor site in human body. (b) Mode of action in human body.

(a) Define Humoral immune response. (1 mark) (b) Name any two types of antibodies found to give humoral immune response in humans. (1 mark)

A health officer visiting two different regions reported the following symptoms in patients: Region A – Sustained high fever with stomach pain, constipation and loss of appetite. Region B – Inflammation in the lower limbs and genital organs. Name the diseases likely affecting the patients in regions A and B. Write the scientific name of the causative organisms in both the cases.

There are many methods to control diseases that are spread by insect vectors. (a) Name any two diseases spread in this manner. (b) What is the function of fishes like Gambusia to control the above diseases?

(a) A person complains of persistent itching in the groin region and scalp. The person also shows dry and scaly lesions on skin, nails, etc. (i) Identify the disease. (ii) Name its two causative agents. (iii) Mention its mode of transmission.

(a) A patient reports a high fever, chills and sweating. His blood shows the presence of a toxic substance. (i) Identify the disease and the causative organism. (ii) Explain why this disease shows recurring pattern of fever.

Name the lymphoid organ that acts as a large reservoir of erythrocytes. Explain its role as a lymphoid organ.

State the role of thymus as a lymphoid organ. Name the cells that are released from it and mention their functions.

(a) Explain how the immunity of a person is affected if there is atrophy (degeneration) of the thymus gland at an early stage of life.

(a) Give an account of the generalised structure of an antibody molecule produced by B-lymphocytes in response to the pathogen.

(a) Give an account of the generalised structure of an antibody molecule produced by B-lymphocytes in response to the pathogen. OR (b) Other than public awareness and counselling, enlist four measures taken up by NACO, WHO and other NGOs to prevent the spread of HIV infection in the society.

Expand PID. Name any two common viral infections transmitted through sexual contact in human females.

Many children in the metro cities are suffering from a very common exaggerated response of the immune system to certain weak antigens in air. (i) What is the term used for the above mentioned disease ? (ii) Name the main type of antibody produced by the immune system in response to this disease. (iii) Which two main inflammation-causing chemicals are produced by the mast cells in such an immune response ?

How does a human body respond when vaccine is introduced into it? It is said that vaccinations are a must for a healthy society. Justify.

Explain any two molecular diagnostic techniques that help to detect pathogens from suspected patient.

(i) How do secondary lymphoid organs provide immunity? (ii) Highlight the role of spleen as an organ that provides immunity.

Identify A, B, C and D in the following table: Scientific name of the plant | Drug | Effect on the human body/human system (a) Papaver somniferum | A | Depressant/slows down body function (b) Cannabis sativa | Cannabinoids | B (c) Erythroxylum coca | C | D

A farmer while working on his farm was bitten by a poisonous snake. He was rushed to a nearby health centre where the doctor gave him an injection to save his life. (i) What did the doctor inject and why ? (ii) Name the kind of immunity provided by this injection.

What is a vaccine ? Write the basis on which it acts when administered in the body.

(a) Mention any two ways by which HIV and Hepatitis-B can be transmitted to a healthy person. (b) Why is an early detection of these diseases essential ?

What are Interferons? State their role in the treatment of cancer.

How is the immune response in humans different from the anti-toxin response? Explain with two reasons.

Ringworm is one of the most common infectious fungal disease in humans. Name any two genera of fungi which cause ringworm and state any of its two symptoms.

State the mode of action of cocaine on human body. Write the scientific name of the source plant it is obtained from.

(a) Mention the scientific name of the source plant and the part from which opioids are extracted. (1 mark) (b) How are morphine and heroin related? Mention the effect each one of them has on human body. (2 marks)

Study the following cases: Case I: A person bitten by a rabid dog is immediately given an injection of antitoxin for rabies. Case II: A child is given rabies vaccine as a preventive measure. (a) Identify the type of immunity provided in both the cases. (b) Differentiate between the two types of immunity. (c) What is a vaccine ? How does it help in preventing a disease ?

(a) A person inhales dust and pathogens but does not always fall sick. Explain how the body protects against such infections. (b) Name and describe any two barriers involved in this protection.

A person inhales dust and pathogens but does not always fall sick. Explain how the body protects against such infections. Name and describe any two barriers involved in this protection.

(a) How do some viruses cause cancer in humans? (b) How do benign tumours turn malignant? How do malignant tumours harm the human body?

(a) Name the cells of the human body attacked by HIV first, when it gains entry into a human body. How does this virus replicate further to cause immunodeficiency in the body? OR (b) Show with the help of a flow chart only, the life-cycle of malarial parasite in human.

Mention the scientific name of the source plant and the part from which opioids are extracted. How are morphine and heroin related? Mention the effect each one of them has on human body.

A person is suffering from high grade fever. Which symptoms will help to identify if he/she is suffering from Typhoid, Pneumonia or Malaria?

(a) Differentiate between humoral immune response and cell-mediated immune response. (b) Draw a schematic diagram of an antibody molecule and label any four parts.

(a) Differentiate between malignant and benign tumours. (b) Name and explain the most feared property of a malignant tumour.

(a) Write the scientific name of the nematode that infests the tobacco plants and the part that it infests. (b) How is Agrobacterium used to protect tobacco plant from this attack?

(a) Name and explain the type of immunity which acts as a biological barrier against several infections during foetal development in the womb. (b) A large proportion of infants remain free from potent infections at least three months after birth, or even longer if breast fed. Explain, giving suitable reasons.

Though filariasis is not fatal, but the disease in humans is responsible for considerable suffering, gross deformities and disability. Write the scientific name of any two helminth worms causing the disease and state two chronic manifestations of filariasis.

(a) A person suffering from AIDS dies of opportunistic infections (infections that could have been otherwise overcome). (i) Why does an AIDS patient suffer from opportunistic infections? Give one reason. (ii) Give the scientific name of one bacterium and one parasite which mainly attack a person suffering from AIDS. (iii) Write the full form of the name of the widely used diagnostic test for AIDS.

When Plasmodium sp. (malarial parasite) enters the human body, it reproduces asexually and increases its number. During this course, the affected person suffers from malaria. After a number of asexual cycles, the parasite, in order to complete its life cycle, enters the sexual phase of its life. Trace the sexual stages in the life cycle of Plasmodium in a female Anopheles mosquito, when it bites an infected person, up to the formation of mature infective stages of the parasite.

A person suffering from AIDS dies of opportunistic infections (ARC) i.e., infections that could have been otherwise overcome. (i) When does an HIV-infected person suffer from AIDS? Give one reason. (ii) Give the scientific name of one bacterium and one parasite which mainly attack a person suffering from AIDS. (iii) Write the full form of the name of the widely used diagnostic test for AIDS.

Over the last century, vaccination has been the most effective medical strategy to control infectious diseases. Explain the principle on which vaccination works.

A person suffering from AIDS dies of opportunistic infections (ARC) i.e., infections that could have been otherwise overcome. (i) At which stage of HIV infection is a person suffering from AIDS?

Explain how a humoral immunity system gets into action when a foreign antigen enters into a human body.

Explain the roles of (i) primary, and (ii) secondary lymphoid organs that are responsible for developing defence to combat the action of pathogens/foreign antigens which enter our body. (b) Doctors generally advise not to undergo surgery of tonsils. Why?

Causative agents of HIV-AIDS and COVID-19 belong to the same group of viruses. To diagnose and amplify the genetic material for further study of COVID-19, RT-PCR test is performed. (a) What does PCR stand for? (b) Explain the various steps of PCR technique.

How does Human Immuno deficiency Virus cause immuno deficiency in the human body?

How is immune response different from antibody response? Explain by giving two reasons.

Explain the roles of (i) primary, and (ii) secondary lymphoid organs that are responsible for developing defence to combat the action of pathogens/foreign antigens which enter our body.

An HIV patient normally doesn't die of 'AIDS', but death is caused due to many other infections. Do you agree with the statement? Give explanatory reasons in support of your answer.

Why do doctors have to carry many tests for selecting a person to be a suitable donor for someone who is going for an organ transplant and not take the organ from just anybody? Explain giving reason.

Different types of antibodies are produced in our body by the B-lymphocytes in response to a pathogen that enters in our blood. Name any two antibodies produced and draw a schematic representation of an antibody molecule and label its four parts.

Many people experience allergic symptoms of sneezing or wheezing on exposure to certain substances in the environment. Give two examples of such substances. Which type of antibodies are produced by the body in response to these substances? Mention the role of mast cells in this kind of allergic response.

(a) (i) Name the protozoan species that is responsible for causing the most serious and even fatal malarial disease. (0.5 marks) (ii) Name the host in which the parasite completes its sexual stages and explain the changes taking place. (2 marks) (iii) How does the parasite damage the human body after entering the blood stream? (1.5 marks) (iv) Suggest two effective preventive measures to control the spread of this disease in endemic regions. (1 mark)

(a) (i) Name the protozoan species that is responsible for causing the most serious and even fatal malarial disease. (½ mark) (ii) Name the host in which the parasite completes its sexual stages and explain the changes taking place. (2 marks) (iii) How does the parasite damage the human body after entering the blood stream? (1½ marks) (iv) Suggest two effective preventive measures to control the spread of this disease in endemic regions. (1 mark) OR (b) (i) What are bio-fertilizers? (1 mark) (ii) Name the different types of microorganisms used as bio-fertilizers in organic farming and explain how each contributes to soil fertility. (3 marks) (iii) Write two advantages of using bio-fertilizers over chemical fertilizers. (1 mark)

Name the protozoan species that is responsible for causing the most serious and even fatal malarial disease. Name the host in which the parasite completes its sexual stages and explain the changes taking place. How does the parasite damage the human body after entering the blood stream? Suggest two effective preventive measures to control the spread of this disease in endemic regions.

(a) A 30 year old man was admitted to a hospital with recurrent infections, weight loss, prolonged fever. His blood report showed a decline in count of T-Lymphocytes thus affecting immune system. (i) Identify the disease and its causative agent. (ii) How did the pathogen affect the immune system once it entered the body ? Explain. (iii) Mention two major modes of its transmission.

A 30 year old man was admitted to a hospital with recurrent infections, weight loss, prolonged fever. His blood report showed a decline in count of T-Lymphocytes thus affecting immune system. Identify the disease and its causative agent. How did the pathogen affect the immune system once it entered the body? Explain. Mention two major modes of its transmission.

(a)(i) Draw the structure of an antibody molecule and label any four of its parts. (ii) Differentiate between active and passive immunity. Write any three differences.

(a) (i) Describe the life cycle of Plasmodium from the time it enters the human body till a female Anopheles mosquito bites an infected person. (ii) Mention the two events of Plasmodium life cycle that occur within the female Anopheles body. OR (b) (i) Write two differences between malignant tumor and benign tumor. (ii) Explain any three diagnostic techniques for the detection of cancer.

(a) (i) Name and explain the property present in normal cells but is lost in cancer cells. (ii) All normal human cells have genes that may become cancerous under certain conditions. Name them and explain how. (iii) State the role of the following techniques in detection and diagnosis of cancer: (1) Biopsy and Histopathology (2) Magnetic Resonance Imaging

Name and explain the property present in normal cells but is lost in cancer cells. All normal human cells have genes that may become cancerous under certain conditions. Name them and explain how. State the role of the following techniques in detection and diagnosis of cancer : (1) Biopsy and Histopathology (2) Magnetic Resonance Imaging

(a) (i) Describe the life cycle of Plasmodium from the time it enters the human body till a female Anopheles mosquito bites an infected person. (ii) Mention the two events of Plasmodium life cycle that occur within the female Anopheles body.

(a) Describe the life cycle of HIV from the time of its entry into the human body till full blown AIDS sets in.

(b) (i) What is smack? Why is the consumption of smack considered as an abuse? (ii) Name the source plant and one effect of the following drugs on the human body: (1) Marijuana (2) Cocaine (3) Morphine

Assertion (A): Flocs are masses of bacteria associated with fungal filaments in secondary treatment of sewage. Reason (R): Flocs help in digestion of solid waste by anaerobic respiration.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation for Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation for Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Microbes commonly used in kitchen are

1. Lactobacillus and Yeast
2. Penicillium and Yeast
3. Microspora and E.coli
4. Rhizopus and Lactobacillus

Assertion (A) : Microbes are used for commercial production of alcohol and beverages. Reason (R) : Yeast converts glucose into ethanol and carbon dioxide during fermentation.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation for Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not correct explanation for Assertion (A).
3. Assertion (A) is true, Reason (R) is false.
4. Assertion (A) is false, Reason (R) is true.

Caenorhabditis elegans is a nematode which is

1. Free living and non-pathogenic
2. Endoparasitic and pathogenic
3. Free living and pathogenic
4. Ecto-parasitic and non-pathogenic

Inoculum used for curd formation is rich in which one of the following components?

1. Vitamin B12
2. Lactic acid bacteria
3. Carbon dioxide
4. Cheese

Name one item from the following which involves the use of bacteria:

1. Wine
2. Penicillin
3. Citric acid
4. Curd

Assertion (A): Activated sludge contains large population of bacteria. Reason (R): These bacteria help in anaerobic digestion of human waste in biogas plant.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Microbes used for biocontrol of pest butterfly caterpillars is:

1. Saccharomyces cerevisiae
2. Bacillus thuringiensis
3. Streptococcus sp.
4. Trichoderma

Assertion (A): Nucleopolyhedrovirus are useful as they are good biocontrol agents. Reason (R): They are species-specific, narrow spectrum bioinsecticides.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Some cyanobacteria in aquatic and terrestrial environment that enrich the soil by fixing nitrogen are:

1. Rhizobium and Azotobacter
2. Azospirillum and Glomus
3. Anabaena and Nostoc
4. Azospirillum and Azotobacter

Assertion (A): Nucleopolyhedrovirus are useful, as they are good biological control agents. Reason (R): They are species-specific narrow spectrum bioinsecticides.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Monascus purpureus is a yeast used commercially in the production of which one of the following?

1. Ethanol
2. Streptokinase
3. Citric acid
4. Statins

Assertion (A): Trichoderma species are free living fungi that are very common in the root ecosystems. Reason (R): They are effective bio-control agents of several plant pathogens.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): Besides curdling of milk, LAB also improves its nutritional quality by increasing Vitamin B12. Reason (R): LAB, when present in the stomach checks disease-causing microbes.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A)
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A)
3. Assertion (A) is true, but Reason (R) is false
4. Assertion (A) is false, but Reason (R) is true

Assertion (A): An increase in BOD indicates that the water is fit for consumption. Reason (R): BOD is a measure of the organic matter present in water.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Bioactive molecule Cyclosporin A used for human welfare is derived from:

1. Propionibacterium sharmanii
2. Monascus purpureus
3. Trichoderma polysporum
4. Aspergillus niger

Bioactive molecule statins used for human welfare are derived from:

1. Trichoderma polysporum
2. Monascus purpureus
3. Propionibacterium shermanii
4. Aspergillus niger

Large scale industrial production of Butyric acid for human welfare is done using the microbe:

1. Aspergillus sp.
2. Streptococcus sp.
3. Clostridium sp.
4. Trichoderma sp.

Assertion (A): Biogas plants are more often built in rural areas. Reason (R): The excreta or gobar of cattle is rich in Methanobacterium.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Large scale industrial production of citric acid for human welfare is done using the microbe :

1. Streptococcus sp.
2. Aspergillus sp.
3. Clostridium sp.
4. Trichoderma sp.

Large scale industrial production of streptokinase for human welfare is done using the microbe :

1. Streptomyces
2. Streptococcus
3. Streptobacilli
4. Streptopneumoniae

Bottled fruit juices are clearer as compared to those made at home, as they are clarified by the use of :

1. Lipases and pectinases
2. Pectinases and proteases
3. Proteases and cellulases
4. Nucleases and lipases

Bacteria growing anaerobically on cellulosic material produce large amounts of which gases ? Select the correct option.

1. CH3, CO2, H2
2. H2, NH3, CH4
3. H2O, Cl2, H2S
4. O2, CH3, H2

Certain viruses used as biological control agents belong to the genus :

1. Nucleopolyhedrovirus
2. Adenovirus
3. Tobacco Mosaic Virus
4. Rhinovirus

Assertion (A): Swiss cheese is characterized by large holes due to CO2 production. Reason (R): It is ripened by growing a specific fungi.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Name the microbe that is used as biocontrol agent for controlling pest butterfly caterpillars:

1. Streptococcus spp.
2. Trichoderma spp.
3. Bacillus thuringiensis
4. Saccharomyces cerevisiae

During biological treatment of sewage, the masses of bacteria held together by fungal filaments to form mesh like structures are called

1. primary sludge
2. flocs
3. activated sludge
4. anaerobic sludge

The first antibiotic was discovered accidentally by A while working on B. 'A' and 'B' are

1. A – Waksman; B – Streptococcus
2. A – Fleming; B – Penicillium notatum
3. A – Waksman; B – Bacillus brevis
4. A – Fleming; B – Staphylococci

Lactobacillus that sets milk into curd is categorised as :

1. Cyanobacteria
2. Archaebacteria
3. Chemosynthetic bacteria
4. Heterotrophic bacteria

Which one of the following pairs is not correctly matched ?

1. Clostridium butylicum - Butyric acid
2. Trichoderma polysporum - Cyclosporin A
3. Monascus purpureus - Citric Acid
4. Streptococcus - Streptokinase

Louis Pasteur dismissed the theory of spontaneous generation by his experiments using pre-sterilised flasks and :

1. Live yeast
2. Killed yeast
3. Live bacteria
4. Killed bacteria

Given below is a list of some commercially important products in column A, whereas in column B are names of source organisms. Select the option where the product and their source organisms are correctly matched.

1. A – (i), B – (ii), C – (iii), D – (iv)
2. A – (iii), B – (ii), C – (iv), D – (i)
3. A – (iv), B – (iii), C – (iv), D – (i)
4. A – (ii), B – (iv), C – (i), D – (iii)

A list of organisms is given in column 'R', whereas in column 'S' a list of products produced by them. Select the option where the organisms are correctly matched with the product. Column 'R' (Organisms): (A) Lactobacillus (B) Saccharomyces cerevisiae (C) Aspergillus niger (D) Acetobacter aceti. Column 'S' (Products): (i) Cheese (ii) Curd (iii) Citric acid (iv) Bread (v) Acetic acid

1. (A)-(ii), (B)-(i), (C)-(iii), (D)-(v)
2. (A)-(ii), (B)-(iv), (C)-(v), (D)-(iii)
3. (A)-(ii), (B)-(iv), (C)-(iii), (D)-(v)
4. (A)-(iii), (B)-(iv), (C)-(v), (D)-(i)

Which one among the following biofertilizers does not fix atmospheric nitrogen?

1. Oscillatoria
2. Rhizobium
3. Azospirillum
4. Glomus

Which one of the following fixes the atmospheric nitrogen but is not an autotroph?

1. Oscillatoria
2. Rhizobium
3. Anabaena
4. Nostoc

Identify the yeast that is famous for Fort Cheese production.

1. Saccharomyces cerevisiae
2. Propionibacterium sharmanii
3. Monascus purpureus
4. Penicillium notatum

A laboratory assistant collected three water samples, namely river water, untreated sewage water and secondary effluent discharged from a sewage treatment plant. But the laboratory attendant did not note which was which. The samples were labelled A, B and C and subjected to a BOD test. The BOD values of the three samples A, B and C were recorded as 30 mg/L, 8 mg/L and 400 mg/L respectively. (a) Which sample of the water is most polluted? (b) Can you assign the correct label to each, assuming the river water is relatively clean?

(a) What is the role of LAB (Lactic Acid Bacteria) in preparation of curd? (1 mark) (b) Mention two health benefits of consuming curd. (1 mark)

After significant reduction of BOD during secondary treatment of sewage, what further processes are carried out ? Mention any one important outcome of these processes.

(b) Give the microbial source and mode of action of the following bioactive molecules : (i) Cyclosporin-A (ii) Streptokinase

Ravi lives in a village where he suggested to the local farmers to introduce a fungus as biofertilizer into their crop fields. State the benefits provided by the fungus to the crop.

List the events that reduce the Biochemical Oxygen Demand (BOD) of a primary effluent during sewage treatment.

Different varieties of cheese are known by their characteristic texture, flavour and taste, the specificity coming from the microbes used. Support this statement with the help of two suitable examples.

(a) Why should antibiotics not be taken indiscriminately? Give any two reasons. (b) It is advisable to complete the course of antibiotics as prescribed by the doctor. Justify.

(a) Write the first step the primary effluent undergoes when it enters the secondary treatment plant and state the purpose. (b) What is the level of B.O.D indicative of in the secondary treatment plant? Mention its significance.

Explain the role of microorganisms in the following: (a) Reducing the sugar content in grape juice (b) Production of a fuel

(a) Name the two institutes which developed the technology of biogas production in India. (b) Explain the main principle used in this technology.

A patient who has undergone an organ transplant is put on immunosuppressants. Name this immunosuppressant and write the name of its source organism.

Can we use slurry of human excreta instead of cowdung slurry to produce biogas in a typical biogas plant? Support your answer giving reasons.

State the most important contribution of the following microbes for human welfare: (a) Monascus purpureus (b) Trichoderma Polysporum

What would be the best method to measure the total population density of a dense bacterial culture in a petridish and why?

Explain how Bacillus thuringiensis acts as a microbial biocontrol agent.

Cow dung and water are mixed and fed into a biogas plant to allow digestion of biowastes. The person performing this process says that there is no need to provide an inoculum. (a) Do you agree with him? Justify your answer. (b) What happens to the biowaste inside the digester? (c) Name the useful by-products obtained from this process and mention how they are used.

(a) Who discovered Penicillin and how ? Explain. (b) Why is this discovery considered accidental ? (c) In what way did it prove to be a 'milestone' in the field of medicine ?

Mention a product of human welfare obtained with the help of each one of the following: (a) Saccharomyces cerevisiae (b) Propionibacterium shermanni (c) Aspergillus niger (d) Trichoderma polysporum (e) Acetobacter aceti (f) Streptococcus

Explain how the following microbes act as biocontrol agents: (a) Bacillus thuringiensis (b) Nucleopolyhedrovirus

Explain the biological treatment of primary effluent when passed into the large aeration tanks in a sewage treatment plant (STP).

Enlist one advantage and two disadvantages of green revolution.

(a) What do you mean by activated sludge in an STP ? (b) Explain the biological treatment of the major part of the sludge transferred from the large aeration tank into the anaerobic sludge digesters before its final release into the natural water bodies.

(a) Write the full form of BOD. (b) Define BOD. Explain how it is a measure of the organic matter present in the water body.

Identify a, b, c, d, e and f in the table given below: Sl. No. | Organism | Bioactive Molecule | Use 1. | Monascus purpureus | a | b 2. | c | d | Antibiotic 3. | e | Cyclosporin A | f

(a) (i) List two major reasons for using cow-dung in a biogas plant instead of using domestic sewage. (ii) Mention one use of the unspent slurry of the biogas plant. OR (b) Name the bioactive molecule and its microbial source generally used by physicians to treat the patients for : (i) Myocardial infarction (ii) High blood cholesterol level (iii) Organ transplantation

Explain the role of the following during the sewage treatment: (a) flocs (b) anaerobic sludge digester

How do the following organisms act as bio-fertilisers ? Explain. (a) Mycorrhiza (b) Anabaena (c) Rhizobium

Treatment of wastewater is done in a sewage treatment plant to make it less polluting. Explain the following with reference to this treatment process: (a) Primary sludge (b) Activated sludge (c) Anaerobic sludge digesters

(a) Write the scientific name of the nematode that infests the tobacco plants and the part that it infests. (b) How is Agrobacterium used to protect tobacco plant from this attack?

Lactic Acid Bacteria (LAB) sets milk into curd and also plays a very beneficial role for human health. Give any two suitable reasons.

Mention the common bacterium found in the anaerobic sludge during sewage treatment and also in the rumen of cattle. How is this bacterium commercially useful?

Different species belonging to genus Trichoderma are useful to humans as well as to plants. Justify their roles by giving one instance of each.

Some of the microbes used as biofertilizers are prokaryotes. Name the taxonomic group they come under. With the help of an example, mention how they act as biofertilizers.

(b) (i) What are bio-fertilizers? (1 mark) (ii) Name the different types of microorganisms used as bio-fertilizers in organic farming and explain how each contributes to soil fertility. (3 marks) (iii) Write two advantages of using bio-fertilizers over chemical fertilizers. (1 mark)

(b) (i) Why are microbes considered effective biocontrol agents in sustainable agriculture ? (ii) Explain the role of the following as biocontrol agents naming the pests or diseases they help to control : (1) A Bacterium (2) A Fungus (3) Virus

Why are microbes considered effective biocontrol agents in sustainable agriculture? Explain the role of the following as biocontrol agents naming the pests or diseases they help to control: (1) A Bacterium (2) A Fungus (3) Virus

Pomato was produced by fusing protoplasts of

1. Tomato and Potato
2. Pomegranate and Tomato
3. Pomegranate and Potato
4. Pomegranate, Potato and Tomato

Match Column-I with Column-II and choose the correct option: Column-I: a. Biolistic gun, b. Chitinase, c. Ti, d. Ca++ | Column-II: i. Bacterial cell, ii. Tumour inducing, iii. Animal cell, iv. Fungal cell, v. Plant cell

1. i ii iii iv
2. ii v i iii
3. v iv ii i
4. v i iv ii

Match Column-I with Column-II and choose the correct option: a. Biolistic gun, b. Chitinase, c. Ti, d. Ca++ with i. Bacterial cell, ii. Tumour inducing, iii. Animal cell, iv. Fungal cell, v. Plant cell

1. a-i, b-ii, c-iii, d-iv
2. a-ii, b-v, c-i, d-iii
3. a-v, b-iv, c-ii, d-i
4. a-v, b-i, c-iv, d-ii

Which one of the following is not a component required for Polymerase Chain Reaction (PCR)?

1. Template DNA
2. Primers
3. DNA Ligase
4. DNA Polymerase

Which of the following statements about plasmids is incorrect?

1. Plasmids have the ability to replicate within the bacterial cell.
2. Their replication is controlled by chromosomal DNA.
3. They are autonomously replicating circular extra-chromosomal DNA.
4. They often carry antibiotic resistant genes.

Expression of a particular gene helps to identify transformants. What is this gene known as?

1. Plasmid
2. Structural gene
3. Selectable marker
4. Intron

Which of the following is used to visualize DNA bands under UV light after gel electrophoresis ?

1. Acetocarmine
2. Safranine
3. Ethidium Bromide
4. Potassium Iodide

Assertion (A) : DNA Ligase is used to join DNA fragments. Reason (R) : It catalyses the formation of glycosidic bonds between nucleotides.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation for Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not correct explanation for Assertion (A).
3. Assertion (A) is true, Reason (R) is false.
4. Assertion (A) is false, Reason (R) is true.

To separate repetitive DNA from bulk genomic DNA, which of the following method is used?

1. Elution
2. Southern Blotting
3. Polymerase Chain Reaction
4. Density Gradient Centrifugation

Genetically modified tobacco plants were produced using Agrobacterium vectors. Which property of Agrobacterium helps in carrying nematode specific genes into the host plant?

1. Infectious for monocot plant; has Ti plasmid
2. Infectious for dicot plant; has Ti plasmid
3. Infectious for plants and animals; has Ti plasmids
4. Infectious for monocot and dicot plants; has cry gene

Restriction enzymes cut the DNA strand at specific recognition sites to form sticky ends. Select the option that describes the sticky ends correctly.

1. Long double-stranded stretches of DNA which hang loosely on both sides.
2. They are over-hanging stretches of RNA.
3. They form hydrogen bonds with their complementary cut counterparts.
4. They are sticky at their ends and hence prevent enzyme action.

Assertion (A): To isolate DNA from plant cell enzyme chitinase is used. Reason (R): Chitinase breaks down the plant cell wall.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Match Column I with Column II and select the correct option: Column I: a. Primers, b. Insertional inactivation, c. Bioreactor, d. Downstream processing Column II: i. β-galactosidase, ii. To separate and purify products, iii. Chemically synthesized oligonucleotides, iv. Large scale production of specific product of activity of microbes

1. a-iii, b-i, c-iv, d-ii
2. a-iii, b-i, c-ii, d-iv
3. a-i, b-iii, c-iv, d-ii
4. a-i, b-iv, c-ii, d-iii

Assertion (A) : DNA cannot pass through cell membrane of a bacterial cell. Reason (R) : DNA is a hydrophilic molecule.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

What does I in restriction enzyme Hind S2I indicate ?

1. It cuts after the first nucleotide in the restriction site.
2. It is the first enzyme isolated from strain S2 of bacterium.
3. Only one enzyme can be used to digest a plasmid from S2 strain.
4. Only one restriction enzyme has been isolated from this bacteria.

Elution means:

1. making the DNA bands visible under UV radiations.
2. separation of DNA fragments on agarose gel.
3. isolating alien DNA from the choice organism.
4. cutting and extraction of DNA bands from the agarose gel.

The construction of the first recombinant DNA was done by using the native plasmid of:

1. E. coli
2. Salmonella typhimurium
3. B. thuringiensis
4. Agrobacterium

Bacillus thuringiensis is used to control which one of the following pathogens/pests?

1. Bacterial pathogen
2. Fungal pathogen
3. Nematodes
4. Insect pests

In pBR322, tetracycline resistance gene (tet R) has recognition site for which of the following restriction endonuclease?

1. Hind III
2. BamH I
3. EcoR I
4. Pst I

Assertion (A): The use of chitinase enzyme is necessary for the separation of DNA from yeast cells but not in the case of Spirogyra. Reason (R): Fungal cell wall is made up of fungal chitin.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Isolation of DNA from a fungal cell can be achieved by using:

1. Cellulase
2. Chitinase
3. Lysozyme
4. Protease

Isolation of DNA from a bacterial cell can be achieved by using :

1. Cellulase
2. Lysozyme
3. Protease
4. Ribonuclease

Isolation of DNA from a plant cell can be achieved by using :

1. Chitinase
2. Lysozyme
3. Cellulase
4. Pectinase

The cloning site present in the tetracycline resistance gene of E. coli cloning vector pBR322 is :

1. EcoR I
2. Pvu II
3. Sal I
4. Pst I

Assertion (A) : Isolated single cells can be fused to produce somatic hybrids. Reason (R) : Cells selected for somatic hybridisation have desirable characters.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

The cloning site present in the rop site of E. coli cloning vector pBR322 is :

1. Pvu II
2. Pst I
3. EcoR I
4. BamH I

The cloning site present in the ampicillin resistance gene of E. coli cloning vector pBR322 is :

1. BamH I
2. EcoR I
3. Pst I
4. Sal I

Identify the incorrect statement regarding PCR.

1. Two sets of primers are required during polymerisation.
2. The process of replication is repeated multiple times to produce one billion copies.
3. Thermostable DNA polymerase is used for extension of primers.
4. Annealing is required to separate both the strands of template DNA.

Assertion (A): A piece of DNA inserted into an alien organism generally does not replicate, if not inserted into a chromosome. Reason (R): ori is where DNA replication is initiated.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

pBR which is frequently used as a vector for cloning gene in E. coli is a/an:

1. Original bacterial plasmid
2. Modified bacterial plasmid
3. Viral genome
4. Transposon

Which one of the following statements is correct in the context of observing DNA separation by agarose gel electrophoresis?

1. DNA can be seen in visible light.
2. DNA can be seen without staining in visible light.
3. Ethidium bromide stained DNA can be seen in visible light
4. Ethidium bromide stained DNA can be seen under UV light.

Which one of the following enzymes a fungal cell should be treated with to get the DNA along with other macro molecules released from it?

1. Isozymes
2. Cellulose
3. Ribonuclease
4. Chitinase

Restriction Endonuclease Hind II always cuts DNA molecules at a particular point by recognising a specific sequence of :

1. Six base pairs
2. Four base pairs
3. Seven base pairs
4. Three base pairs

Using a DNA template, how many new DNA molecules would be generated after 10 cycles of amplification in PCR?

1. 512
2. 1024
3. 2048
4. 256

Which one of the following bacteria were used by Stanley Cohen and Herbert Boyer to accomplish the construction of the first rDNA ?

1. Agrobacterium tumefaciens
2. Mycobacterium sp.
3. E. coli
4. Salmonella typhimurium

Which one of the following is not a feature of plasmids ?

1. Circular
2. Self-replicating
3. Single stranded
4. Extra-chromosomal

Assertion (A) : Specific enzymes are used to degrade the cell wall in organisms to isolate the DNA from the cell. Reason (R) : Fungal cell wall is degraded by the enzyme cellulase.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A)
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A)
3. Assertion (A) is true, but Reason (R) is false
4. Assertion (A) is false, but Reason (R) is true

Which one of the following is not used as a vector for rDNA technology?

1. Plasmid
2. Bacterial cell
3. Bacteriophage
4. Retrovirus

Which native plasmid did Stanley Cohen and Herbert Boyer use for the construction of the first recombinant DNA ?

1. Salmonella typhimurium
2. Streptococcus pneumoniae
3. Escherichia coli
4. Haemophilus influenzae

Assertion (A) : The stirrer facilitates the even mixing of oxygen availability in a bioreactor. Reason (R) : Stirred-tank bioreactors generally have a flat base.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

For the replication of the first recombinant DNA, Stanley Cohen and Herbert Boyer used the DNA polymerase of :

1. Thermus aquaticus
2. Salmonella typhimurium
3. Escherichia coli
4. Haemophilus influenzae

The linking of the antibiotic resistance gene with the plasmid vector of Salmonella typhimurium by Stanley Cohen and Herbert Boyer was made possible by the enzyme :

1. Taq polymerase
2. DNA ligase
3. Restriction endonuclease
4. β-galactosidase

Study the following list of bioactive substances and their action: Select the option in which the bioactive substances are correctly matched with their action.

1. A – II, B – III, C – I, D – IV
2. A – III, B – IV, C – II, D – I
3. A – IV, B – I, C – II, D – III
4. A – IV, B – II, C – I, D – III

The 'molecular scissors' fall in the category of :

1. Cleaving enzyme
2. Endonuclease
3. Exonuclease
4. Restriction enzymes

The commonly used vector for human genome sequencing was/were:

1. Retrovirus
2. T-DNA
3. BAC and YAC
4. Plasmid Vector

Assertion (A): Agrobacterium tumefaciens is a pathogen of several monocot plants. Reason (R): It is able to deliver a piece of DNA known as T-DNA to transform normal plant cells into a tumor.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): In genetic engineering, antibiotic genes are used as selectable markers. Reason (R): Selectable markers help us to identify transformants from non-transformants.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): A recombinant DNA which is inserted within the coding sequence of β-galactosidase does not produce blue coloured colonies when treated with a chromogenic substrate. Reason (R): Insertional inactivation occurs when a recombinant DNA is introduced in the coding sequence of the enzyme.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

The organism used in construction of the first artificial recombinant DNA by Cohen and Boyer in 1972 was:

1. E. coli
2. Salmonella typhimurium
3. Agrobacterium tumefaciens
4. Bacillus thuringiensis

Assertion (A): In order to cut the DNA with a restriction enzyme, it needs to be released from the membrane which encloses it. Reason (R): A plant cell was treated with chitinase to achieve this.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Write the importance of following in biotechnology: (a) Ori (Origin of Replication) (1 mark) (b) Enzyme Polymerase used in Polymerase Chain Reaction (1 mark)

How do scientists use microinjection and gene gun in biotechnology ?

Briefly describe the process of DNA extraction from a fungal cell. Name the chemicals used in the process.

Mention the key tools of Recombinant DNA technology. Write a line about any four of them, giving their function.

(b) After performing gel electrophoresis, a student observes that DNA fragments are not visible. (i) Suggest a reason for this and explain how fragments can be made visible. (ii) Also explain how a specific DNA fragment can be collected from the gel for further use.

(a) Given below is the schematic representation of the process of electrophoresis. Identify the alphabets representing the : (I) Anode end, and (II) Lightest/Smallest DNA in matrix. (ii) What is Agarose gel and why is it used in this process ?

Write the role of 'ori' and 'restriction' site in a cloning vector pBR322.

Why and how can bacteria be made 'competent'?

(b) In order to force bacteria to take up the recombinant DNA, they must be made competent. Explain how it can be achieved.

Suggest how a virus-free healthy plant can be obtained from a diseased sugarcane plant.

Explain any two methods of vectorless gene transfer.

Name the enzyme used in Step-1 to join the cut plasmid and alien DNA. State the technical term used for Step-3. Justify the use of same Restriction Enzyme EcoR I to cut both the vector DNA and the alien DNA.

(a) Name the enzyme used in Step-1 to join the cut plasmid and alien DNA. (b) State the technical term used for Step-3. (c) Justify the use of same Restriction Enzyme EcoR I to cut both the vector DNA and the alien DNA.

The basic scheme of the essential steps involved in the process of recombinant DNA technology is summarized below in the form of a flow diagram. Step-1: Vector DNA (cut using Restriction Enzyme EcoR I) + Alien DNA (cut using Restriction Enzyme EcoR I) → Enzyme A → Step-2: Recombinant DNA molecule → Step-3 → Transfer of recombinant DNA molecule in E. coli (Host) → Step-4: Replication of recombinant DNA molecule in E. coli

(a) Name the specific enzyme that might have been used to make the multiple copies of foreign DNA before undergoing Step-1 of the process.

The basic scheme of the essential steps involved in the process of recombinant DNA technology is summarised below in the form of a flow diagram. Step 1: Vector DNA (Plasmid) + Alien DNA (cut using Restriction Enzyme). Step 2: Recombinant DNA molecule. Step 3: Transfer of recombinant DNA molecule in E. coli (Host). Step 4: Replication of the recombinant DNA molecule in E. coli to form multiple copies of the alien gene. (a) What is the technical term used for Step 4 in the above process ?

How is DNA isolated in purified form from a bacterial cell?

State the role of ori and restriction site in pBR322.

How is a restriction endonuclease named? Explain with the help of a suitable example.

How is Ti plasmid of Agrobacterium tumefaciens modified to act as a cloning vector?

(a) Vectors are DNA molecules that can carry a foreign DNA segment into the host cell. (i) Write the characteristics of vectors. (ii) Give one example each of vectors used for cloning genes in plants and animals.

(a) Restriction enzyme is an important tool to detect recombinant DNA. Explain the method. OR (b) Explain how recombinant DNA technology is used to detect a disease even before any clinical symptom appears.

There are limitations of traditional breeding techniques that led to promotion of micro-propagation? (a) Mention two advantages of micropropagation. (b) Give two examples where it is commercially adopted.

(a) Why must a cell be made 'competent' in biotechnology experiments? How does calcium ion help in doing so? (b) State the role of "biolistic gun" in biotechnology experiments.

Draw a schematic diagram of the E.coli vector pBR 322 and mark the following in it: (a) ori (b) rop (c) ampicillin resistant gene (d) tetracycline-resistant gene (e) restriction site Bam HI (f) restriction site EcoRI

With the help of a schematic diagram only, show in three steps, the formation of recombinant DNA by the action of restriction endonuclease EcoRI and DNA ligase.

With the advent of sophisticated techniques of genetic engineering, we can now readily purify and isolate DNA. Name and explain the different steps involved in the separation and isolation of DNA fragments once cut by restriction endonucleases.

(a) Draw a labelled diagram of a simple stirred-tank bioreactor. (b) State why a simple-stirred tank bioreactor generally has a curved base.

With the help of a storyboard or a flowchart only, explain all the stages of how human insulin is produced through r-DNA technology.

Explain the various steps of PCR technique.

Only with the help of a labelled diagram, show the steps of formation of recombinant DNA by the action of restriction endonuclease enzyme EcoR I.

A cell free method of amplifying DNA first developed in the mid 1980's revolutionized the field of biotechnology. Name the method and explain the basic steps of the technique involved.

A host cell must be made competent, before it is able to receive an rDNA. Justify.

Non viral and non vector methods are sometimes used to transfer genes or alien DNA into a plant cell. Explain one such method used in genetic engineering.

(a) Describe the steps involved in Recombinant DNA technology in a specific sequence. OR (b) (i) In Recombinant DNA technology, it is essential to first make the bacterial cells 'competent'. How is this process carried out? (ii) Name and explain the methods by which an alien DNA can be made to enter: (I) a plant cell, (II) an animal cell.

(a) (i) Explain any two basic principles/core techniques on which biotechnology is based. (ii) Describe any three key tools used in Recombinant DNA technology.

(a)(i) EcoR I has played a very important role in rDNA technology. (I) Explain the convention for naming EcoR I. (II) Write the recognition site of this endonuclease restriction enzyme. (ii) Name the overhanging stretches of DNA produced by these restriction enzymes. Describe their role in the formation of rDNA.

(a)(i) EcoR I has played a very important role in rDNA technology. (I) Explain the convention for naming EcoR I. (II) Write the recognition site of this restriction endonuclease enzyme. (ii) Name the overhanging stretches of DNA produced by these restriction enzymes. Describe their role in the formation of rDNA.

(b)(i) Insertional inactivation is a method to detect the recombinant DNA. Explain this method. (ii) Name the commonly used vector for transferring genes in plants from bacteria. (iii) How is this able to transform a normal plant cell into a tumour?

Explain the amplification of gene of interest using the technique of Polymerase chain reaction (PCR).

(b) Describe the structure and working of a sparged stirred-tank bioreactor.

(a) (i) Explain how some strains of Bacillus thuringiensis produce proteins that kill certain insects such as lepidopterans but do not kill the Bacillus. (ii) How is the above mechanism exploited for the production of Bt cotton plant by biotechnologists ?

(b) Describe the technique of a typical agarose gel electrophoresis used for the separation and isolation of DNA fragments.

(b) (i) Explain the working of a simple stirred-tank bioreactor. (ii) Describe what is meant by downstream processing.

(a) (i) Draw a schematic diagram of the cloning vector pBR 322 and label (1) Bam HI site (2) gene for ampicillin resistance (3) 'ori' (4) 'rop' gene. (ii) State the role of 'rop' gene. (iii) A cloning vector does not have a selectable marker. How will it affect the process of cloning? (iv) Why is insertional inactivation preferred over the use of selectable markers in cloning vectors?

(a) (i) Why should a cell be made competent to take up an alien DNA ? How can a bacterial cell be made competent using calcium ions ? Explain. (ii) (1) State the importance of gel electrophoresis in biotechnology. (2) Explain the principle on which this technique works. (3) Mention why ethidium bromide is used in this technique.

(a) (i) Why should a cell be made competent to take up an alien DNA? How can a bacterial cell be made competent using calcium ions? Explain.

(a) Answer the following questions with respect to recombinant DNA technology: (i) Why is plasmid considered to be an important tool in rDNA technology? From where can plasmids be isolated? (Any two sources) (ii) Explain the role of restriction endonuclease and DNA ligase as a vector. (iii) Prove that recombinant DNA technology cannot proceed without restriction endonuclease enzyme.

(a) Answer the following questions with respect to recombinant DNA technology: (i) Why is plasmid considered to be an important tool in rDNA technology? From where can plasmids be isolated? (Any two sources) (ii) Define the term expression vector. (iii) Justify that rDNA technology cannot proceed without restriction endonuclease.

(a) Answer the following questions with respect to recombinant DNA technology: (i) Why is plasmid considered to be an important tool in rDNA technology? From where can plasmids be isolated? (Any two sources) (ii) Write the significance of restriction endonuclease and DNA ligase as a vector. (iii) Justify the statement that rDNA technology cannot proceed without restriction endonucleases. OR (b) Answer the following questions based on Bt-crops: (i) Why do farmers prefer to grow Bt cotton crop than genetically unmodified cotton crops? (ii) Name any two insects that are killed by Bt toxin. (iii) Explain the mechanism by which Bt toxin kills the insects but not the bacterium which possesses the toxin.

C-peptide of human insulin is:

1. a part of mature insulin molecule
2. responsible for formation of disulphide bridges
3. removed during maturation of pro-insulin to insulin
4. responsible for its biological activity

Assertion (A): The milk produced by transgenic cow 'Rosie' was nutritionally more balanced product for human babies than natural cow milk. Reason (R): It was human protein enriched milk containing human alpha lactaglobulin.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation for Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation for Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Pomato was produced by fusing protoplasts of

1. Tomato and Potato
2. Pomegranate and Tomato
3. Pomegranate and Potato
4. Pomegranate, Potato and Tomato

Genetically modified tobacco plants were produced using Agrobacterium vectors. Which property of Agrobacterium helps in carrying nematode specific genes into the host plant ?

1. Infectious for monocot plant ; has Ti plasmid
2. Infectious for dicot plant ; has Ti plasmid
3. Infectious for plants and animals ; has Ti plasmids
4. Infectious for monocot and dicot plants ; has cry gene

Assertion (A): Organisations like GEAC are necessary to monitor GM researches and to test the safety of introducing Genetically Modified organisms for public services. Reason (R): GM researches can have unpredictable results which can even be disastrous, when Genetically Modified organisms are introduced into the ecosystem.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Golden rice is a promising transgenic crop. When released for cultivation, it will help in:

1. Producing petrol-like fuel
2. Reduction of Vitamin A deficiency in humans
3. Pest resistance
4. Herbicide tolerance

In RNAi, genes are silenced using which of the following biomolecules?

1. ssDNA
2. dsDNA
3. dsRNA
4. ssRNA

Protein encoded by gene Cry-I Ab controls the infestation of which of the following?

1. Cotton bollworms
2. Mosquitoes
3. Corn borer
4. Agrobacterium

The recombinant protein obtained from transgenic animals that could be used to treat emphysema is:

1. Humulin
2. α-lactalbumin
3. α-1-antitrypsin
4. Iodothyronine

Transgenic animals have their genetic material manipulated. Select the correct option in reference to transgenic animals.

1. Foreign DNA and RNA are present in their cells.
2. Foreign RNA is present in all of their cells.
3. Foreign DNA is present in all of its cells.
4. Foreign RNA is present in some of its cells.

Bt-toxin genes have been expressed in plants in order to provide resistance against: (i) lepidopterans and fungi (ii) animals and bacteria (iii) coleopterans and dipterans (iv) lepidopterans

1. (ii) and (iii)
2. (i), (ii) and (iv)
3. (iii) and (iv)
4. (ii) and (iv)

Assertion (A): Genetically modified microbes help in crop protection. Reason (R): Bacillus thuringiensis (Bt) bacteria control insects by producing prototoxins.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): Virus-free plants can be obtained in vitro from an infected plant. Reason (R): If the plant is infected with a virus, the roots and the stems are free of virus.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): in vitro-free plants from an infected plant. Reason (R): If the plant is infected with a virus, the roots and the stems are free of virus. Select the correct answer to these questions from the codes (A) Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A). (B) Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A). (C) Assertion (A) is true, but Reason (R) is false. (D) Assertion (A) is false, but Reason (R) is true.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A)
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A)
3. Assertion (A) is true, but Reason (R) is false
4. Assertion (A) is false, but Reason (R) is true

The most widely used transgenic animal for testing the safety of vaccine before they are used in humans is:

1. Rabbits
2. Pigs
3. Sheep
4. Mice

Assertion (A): To generate only a part of the plant from a cell is totipotency. Reason (R): Suitable special nutrient media and sterile conditions are required in r conditions for the division of cells in explants.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): To generate only a part of the plant from a cell is totipotency. Reason (R): Suitable special nutrient media and sterile conditions are required in conditions for the division of cells in explants.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A) : Isolated single cells can be fused to produce somatic hybrids. Reason (R) : Cells selected for somatic hybridisation have desirable characters.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Which one of the following is not the product of transgenic experiments?

1. Pest-resistant crop variety
2. High nutritional value in grains
3. Drought-resistant crops
4. Production of insulin by rDNA technique

Out of the following, select the correct match:

1. Transgenic cow milk - Human beta-lactalbumin protein
2. ELISA - Antigen antibody interaction
3. Corn Borer - Cry II Ab gene
4. Cotton plant - Meloidegyne Incognitia

Assertion (A): Biotechnology produces transgenic microorganisms that function as microfactories for proteins. Reason (R): Transgenic microorganisms can be developed to produce proteins of human use, like insulin.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): In molecular diagnosis, single stranded DNA or RNA tagged with radioactive molecule is called a probe. Reason (R): A probe always searches and hybridises with its complementary DNA in a clone of cells.

1. Both (A) and (R) are true and (R) is the correct explanation of (A).
2. Both (A) and (R) are true, but (R) is not the correct explanation of (A).
3. (A) is true, but (R) is false.
4. (A) is false, but (R) is true.

ELISA technique is based on the principle of

1. DNA replication
2. antigen-antibody interaction
3. pathogen – antigen interaction
4. antigen – protein interaction

Which one of the following transgenic animals is being used to test the safety of the polio vaccine ?

1. Sheep
2. Goat
3. Pig
4. Mice

The improved trait that is found in the genetically modified transgenic crop Golden rice is :

1. High lysine content
2. Insect resistant
3. High protein content
4. High vitamin-A content

Assertion (A): Indian Government has set up an organisation known as GEAC to decide the validity of GM research. Reason (R): Genetic modification of organisms has no effect when such organisms are introduced in the ecosystem.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

The specific Bt toxin genes which protect the cotton plants against the cotton bollworms are:

1. Cry-I Ac and Cry-II Ab
2. Cry-I Ab and Cry-I Bc
3. Cry-II Ac and Cry-I Ac
4. Cry-II Ab and Cry-I Ab

Assertion (A): Functional ADA cDNA genes must be inserted in the lymphocytes at the early embryonic stage in gene therapy for ADA deficiency. Reason (R): Cells in the embryonic stage are immortal, differentiated and easy to manipulate.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): Patents are granted by government to an inventor. Reason (R): Patents prevents others from commercial use of an invention.

1. Both (A) and (R) are true and (R) is the correct explanation of (A).
2. Both (A) and (R) are true and (R) is not the correct explanation of (A).
3. (A) is true, but (R) is false.
4. (A) is false, but (R) is true.

Which of the following is used to inactivate the desired gene during the RNAi process?

1. dsDNA
2. dsRNA
3. rDNA
4. DNA polymerase

Who among the following challenged the patent right granted to the Mississipi University for the healing properties of Turmeric?

1. Mr. Ajay Phadke
2. Ms. Vandana Shiva
3. Dr. Venugopalan
4. Dr. R.A. Mashelkar

Assertion (A): A patient of ADA deficiency undergoing treatment for gene therapy requires periodic infusion of genetically engineered lymphocytes. Reason (R): Lymphocytes are immortal.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Which one of the following products was produced as a result of DNA engineering (gene transfer) in cow ?

1. α-1-antitrypsin
2. β-lactalbumin
3. β-lactglucose
4. ADA-deaminase

After the completion of biosynthetic stage in a bioreactor, the product undergoes a series of processes before it is ready for marketing. List of the processes is given below. Identify the option that gives the correct sequence of the processes carried out : (i) Purification of product (ii) Formulation with suitable preservative (iii) Separation of product (iv) Clinical trial of product

1. (ii) (iii) (i) (iv)
2. (iii) (ii) (i) (iv)
3. (iii) (i) (ii) (iv)
4. (i) (iii) (iv) (ii)

Assertion (A) : Crystal protein Bt toxin does not kill the Bacillus but kills the insects. Reason (R) : Bt toxin exists in inactive form in Bacillus but when ingested by the insect, the acidic pH of its gut changes it into an active form.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

The first gene-sequenced crop is:

1. Wheat
2. Tobacco
3. Rice
4. Cotton

A patent with Type I diabetes is unable to produce sufficient insulin. (a) How has recombinant DNA technology helped in addressing this problem? (b) Mention its advantage over animal derived insulin.

GEAC is a regulatory body under the Ministry of Environment, Forest and Climate Change in India. (a) Write the full form of GEAC. (b) Mention two of its important functions related to biotechnology.

A foreign company patented the medicinal use of turmeric already known to Indian households. (a) Name and define this unethical practice. (b) What has the Indian Government done to check this ?

A child is born with a genetic disorder due to the deletion of a gene. (a) Name such a gene studied by you. Explain how gene therapy can help in treating such a condition. (b) Mention one challenge associated with this therapy.

(a) Suggest how a virus-free healthy plant can be obtained from a diseased sugarcane plant.

Name the Indian crop variety for which, in 1997, an American company got patent rights through the US Patent and Trademark Office. This is considered a case of Biopiracy. Justify.

Biotechnology has helped farmers to get pest-resistant cotton plants. Explain the technique adopted along with its mode of action.

Explain how human functional insulin was produced by using recombinant DNA (rDNA) technology.

(a) Name the source from which insulin was extracted in earlier times. Why is this insulin no more in use by the diabetic patients ? (b) Why does the insulin synthesised in the human body undergo processing whereas the insulin produced by Eli Lilly company does not need to undergo any processing ? Explain.

Why does a patient of ADA – deficiency require repeated infusions of genetically engineered lymphocytes ? Suggest a possible permanent remedy.

(a) Name the first developed transgenic cow. (b) Explain the improvement in the quality of the milk produced by it.

Expand the term 'ELISA'. On which principle is the 'ELISA' test based? Explain the process.

A farmer grew two varieties of corn crop in field A and B. He grew normal corn crops in field A and GM corn crops in field B. He observed that corn borers attacked only in field A. To control it, spores of Bt were sprayed on field A. (a) Name the gene in the spores responsible for control of pest. (0.5 marks) (b) What effect will the spores of Bt have on insect pest? (1.5 marks) (c) How has corn plants of field B developed resistance against this pest? Explain. (1 mark)

A farmer grew two varieties of corn crop in field A and B. He grew normal corn crops in field A and GM corn crops in field B. He observed that corn borers attacked only in field A. To control it, spores of Bt were sprayed on field A. (a) Name the gene in the spores responsible for control of pest. (½ mark) (b) What effect will the spores of Bt have on insect pest? (1½ marks) (c) How has corn plants of field B developed resistance against this pest? Explain. (1 mark)

Suggest and describe a technique through which a healthy sugarcane plant can be obtained from virus infected sugarcane plant.

There are limitations of traditional breeding techniques that led to promotion of micro-propagation. Mention two advantages of micropropagation. Give two examples where it is commercially adopted.

(a) How is insulin different from proinsulin? (b) Explain all the stages of how human insulin is produced through rDNA technology.

Transgenic animals are produced by man. Explain any three ways in which such animals can be beneficial to humans.

Write the scientific name of the nematode that infects tobacco plants. Also name the part of the plant that it infects. How is Agrobacterium used to protect tobacco plants from attack by this pest?

Enlist three advantages of genetically modified plants.

Explain the beneficial role of the following, produced as a result of the processes of biotechnology, to mankind : (a) Cow named Rosie (b) α-1-antitrypsin

(a) Why are transgenic animals so called? (b) With the help of an example each, explain the role of transgenic animals in the following: (i) Vaccine safety (ii) Biological products

Name the process involved in the production of nematode-resistant tobacco plants, using genetic engineering. Explain the strategy adopted to develop such plants.

Gene therapy can be used to treat an ADA deficient patient. Explain. Is it a permanent cure? How can ADA be cured permanently?

The first clinical gene therapy was given in 1990 to a 4-year-old girl with ADA deficiency. (a) Mention the cause of this disorder. (b) List the possible treatments available for this disorder. (c) How can this disorder be cured permanently?

What are transgenic animals ? Name the first transgenic cow and state its importance.

(a) What are transgenic animals? (b) Name the transgenic animal having the largest number amongst all the existing transgenic animals. (c) State any 3 reasons for which these types of animals are being produced.

(a) (i) What are transgenic animals ? (ii) Name the first transgenic cow and state its importance. OR (b) (i) Explain the convention for naming EcoRI. (ii) With the help of an illustration only, show the action of EcoRI on a DNA Polynucleotide.

(a) (i) What are transgenic animals? (ii) Name the first transgenic cow and state its importance.

(a) Give the scientific name of the bacteria widely used in biotechnology to create a GM cotton crop resistant to bollworm attacks. (b) Explain how GM cotton crop is able to resist insect attacks.

(a) Mention the advantages of ART. (b) Explain the ICH and AI methods of assisted reproductive technologies.

Explain the role of transgenic animals in: (a) Production of Biological products (b) Studying diseases (c) Chemical safety testing

How has the use of Agrobacterium as vector helped in controlling Meloidogyne incognita infestation in tobacco plants ? Explain in correct sequence.

(a) Define stem cells. (b) From where can one obtain stem cells in humans? (c) State any two applications of stem cells in curing human diseases.

(a) Give characteristic features of stem cells. (b) From where can one obtain stem cells in humans? (c) State any two applications of stem cells in curing human diseases.

An application of biotechnology in agriculture involves production of Bt crops. Name the organism from which the gene has been isolated. Explain that this gene is dominant for the organism itself, but it is not lethal to it.

Development of recombinant DNA technology has made it possible to express foreign genes in heterologous systems/bacteria or any other organism. Give an example of a vaccine developed by such a technology and the host used.

An application of biotechnology in agriculture involves production of pest resistant Bt corn using Bacillus thuringiensis. (a) Proteins coded by which specific Bt toxin genes control corn borer?

Bacillus thuringiensis plays an important role in Integrated Pest Management strategy. Explain how. Name any two crops that are protected efficiently from pests.

Genetically modified transgenic plants are considered superior to conventional plants. Explain by giving three reasons.

How does a gene therapy involving direct modification of the cells, in order to achieve a therapeutic goal is used in the treatment of ADA deficiency? Explain.

Explain how recombinant human insulin was prepared in 1983 by Eli Lily an American company.

(b) "Early and accurate diagnosis of diseases is vital in medical technology." (i) Name the conventional methods of diagnosis and their disadvantages. (ii) Which three diagnostic techniques have been developed through Biotechnology? Explain how each one helps in detecting diseases.

Name and explain the biotechnological strategy wherein the infection by the nematode Meloidegyne incognitia can be prevented using Agrobacterium vectors in the roots of tobacco plant by RNA interference.

(a) (i) Name the two genes encoding for the Bt toxin protein used in biotechnology for the control of cotton bollworms. (ii) How does the expression of Bt toxin gene in Bt cotton plant help in providing resistance to cotton bollworms? Explain.

(a) (i) ELISA test is based on which principle? (ii) Describe all the methods used to treat or cure Adenosine deaminase deficiency in humans.

(a) Define transgenic animals. Explain in detail any four areas where they can be used for human benefit.

(a) (i) Explain why the insecticidal protein producing by Bacillus thuringiensis does not kill the bacteria itself. (ii) How has man exploited this protein to produce cotton bollworm resistant Bt cotton plant ?

(a) Explain how the process of RNA interference technology is used effectively to prevent infestation of the roots of tobacco plant by the nematode Meloidegyne incognitia. OR (b) Explain how more than a billion copies of a fragment of DNA are formed using the technique of PCR.

(a) (i) Describe the approach of gene therapy used for the treatment of a 4-year-old girl suffering from Adenosine Deaminase Deficiency. (ii) What is meant by micropropagation ? Name any two important food plants grown commercially (on a large scale) by this method.

(a) (i) Explain how human pro-insulin is processed in the cell to become a fully mature functional insulin. (ii) Describe how human insulin is produced using the techniques of genetic engineering.

(b) Bt cotton, the genetically modified crop, has greatly helped the cotton farmers to increase their crop yield. (i) How was Bt cotton plant made resistant to bollworm ? Explain. (ii) Describe the mechanism that leads to the death of bollworms feeding on Bt cotton plants.

(b) Bt cotton, the genetically modified crop, has greatly helped the cotton farmers to increase their crop yield. (i) How was Bt cotton plant made resistant to bollworm? Explain.

(b) Answer the following questions based on Bt-crops: (i) Why do farmers prefer to grow Bt cotton crop than genetically unmodified cotton crops? (ii) Name any two insects that are killed by Bt toxin. (iii) Explain the mechanism by which Bt toxin kills the insects but not the bacterium which possesses the toxin.

Which of the following is an important parameter for assessing the impact of any biotic or abiotic factor on population growth?

1. Birth rate
2. K-carrying capacity
3. Death rate
4. r-Intrinsic rate of natural increase

Connell's elegant field experiments on the rocky seacoast of Scotland, found that larger barnacles Balanus dominated the intertidal area and removed the smaller barnacles Chathamalus. This happened due to:

1. Parasitism
2. Predation
3. Mutualism
4. Competition

Assertion (A): The interaction between a whale and the small barnacles on its back is considered as commensalism. Reason (R): In the above association, neither of the species is benefitted.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Choose a correct option that shows an interaction in which one species benefits while the other is neither harmed nor benefitted.

1. Mycorrhizal associations between fungi and roots of higher plants
2. Sea anemone and clownfish
3. Abingdon tortoises and goats in the Galapagos Island
4. Cuscuta on hedge plants

A biologist studied the population of rats in a granary. He found the average natality was 280, average mortality was 200, immigration was 40 and emigration was 50. The net increase in population is:

1. 80
2. 70
3. 10
4. 90

Assertion (A): A given fig species can be pollinated only by its partner' wasp. Reason (R): The wasp pollinates the fig inflorescence while searching for suitable egg laying sites.

1. Both (A) and (R) are true and (R) is the correct explanation of (A).
2. Both (A) and (R) are true and (R) is not the correct explanation of (A).
3. (A) is true, but (R) is false.
4. (A) is false, but (R) is true.

Assertion (A): Communities that comprise of more species tend to be more stable. Reason (R): A higher number of species results in less year to year variation in total biomass.

1. Both (A) and (R) are true and (R) is the correct explanation of (A).
2. Both (A) and (R) are true, but (R) is not the correct explanation of (A).
3. (A) is true, but (R) is false.
4. (A) is false, but (R) is true.

Assertion (A): A cattle egret and grazing cattle in close association is a classic example of commensalism. Reason (R): As grazing cattle move through the field, they stir up and flush out insects from the vegetation that otherwise might be difficult for egrets to find and catch.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Examples that show commensalism are: (i) An orchid growing on mango tree (ii) Cuckoo bird and crow (iii) Cuscuta growing on Nerium tree (iv) Barnacles growing on a whale

1. (i) and (ii)
2. (i) and (iv)
3. (ii) and (iii)
4. (ii) and (iv)

Assertion (A): A species of wasp and a fig species cannot complete their life cycle without each other. Reason (R): While visiting wasps come to lay eggs in the fig inflorescence, the flower of wasp gets pollinated in return.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Identify the option that does not exhibit a parasitic relationship.

1. Head lice in humans
2. Cuscuta on a mango tree
3. Female Anopheles
4. Ticks on dogs

(a) In some cases, measuring population density by counting individuals may not be feasible. Mention two other parameters that can be used and justify their use with suitable examples.

(a) Explain the type of interaction between: (i) Egret and Cattle (ii) Cuckoo and Crow

Explain how the interaction between sea anemone and clownfish is one of the best examples of commensalism in nature.

(a) Explain how the interaction between a fig tree and its tight one-to-one relationship with the pollinator species of wasp is one of the best examples of mutualism.

Explain how are plants benefitted by their association with "Glomus species".

List and explain any two factors that lead to a decrease in the population density of an area.

When tourists go to places of high altitude like Rohtang Pass or Mansarovar, they are advised not to venture out for two days at least to get acclimatized to the prevailing conditions there. Explain how they get acclimatized.

Answer the following questions: (a) Name the type of interaction seen between fig tree and wasps. (b) Mention the benefits that the female wasps desire from the fig tree from such an interaction. (c) Give one example where animal-plant interaction involves 'co-evolution' other than the relationship between fig tree and wasps.

(a) What is the carrying capacity of a species in a habitat? (b) Explain the growth curve that takes this capacity into account.

Explain Gause's 'Competitive Exclusion Principle' with the help of a suitable example.

Given below is an equation describing the growth pattern of a population: dN/dt = rN (a) Mention the type of growth model or growth pattern of the population described by the given equation. (b) What does 'r' in the equation signify? (c) Mention the type of growth curve that will be obtained if the population density (N) is plotted against time (t). (d) According to you, will the resource availability be limited or unlimited for this type of growth in the given population?

Describe how fig tree and wasp relationship is a spectacular example of mutualism.

Explain the following population interactions with the help of one example each: (a) Brood Parasitism (b) Co-evolution of mutualists

Explain the two physiological attributes which enable a kangaroo rat to survive in desert conditions.

State two morphological attributes observed in the leaves of desert plants that enable them to survive in extreme conditions in the desert.

To survive unfavourable conditions, some organisms hibernate and others go into aestivation. How is hibernation different from aestivation? Give one example of each.

Write the best method to measure the population density of a single Banyan tree in comparison to 20 Parthenium weeds in a forest by an ecologist. Explain and justify your answer.

Write the observations made at the end of Connell's field experiment on barnacles on the rocky sea coasts of Scotland.

(i) Write the observations made at the end of Connell's field experiment on barnacles on the rocky sea coasts of Scotland. (ii) Name any two categories of organisms that in general are adversely affected by competition.

Many members of genus Glomus form a mycorrhizial association with plants. Elaborate how is this association beneficial to the plants.

What would be the best method to measure the total population density of the number of fishes in river and why?

Describe the population growth curve applicable in a population of any species in nature that has limited resources at its disposal. Give the equation of this growth curve. Name the growth curve and depict a graphical plot for this type of population growth.

(a) (i) Describe the population growth curve applicable in a population of any species in nature that has limited resources at its disposal. (ii) Give the equation of this growth curve. (iii) Name the growth curve and depict a graphical plot for this type of population growth.

(a) (i) Describe the population growth curve applicable in a population of any species in nature that has unlimited resources at its disposal. (ii) Explain the equation of this growth curve. (iii) Name the growth curve and depict a graphical plot for this type of population growth.

(a) (i) Describe the population growth curve applicable in a population of any species in nature that has unlimited resources at its disposal. (ii) Explain the equation of this growth curve. (iii) Name the growth curve and depict a graphical plot for this type of population growth. OR (b) (i) Explain the conclusion drawn by Alexander von Humboldt during his extensive explorations in the wilderness of South American jungles. (ii) Give the equation of the Species-Area relationship. (iii) Draw a graphical representation of the relation between species richness and area for a wide variety of taxa such as birds, bats, etc.

(b) (i) Describe the logistic population growth curve with the help of a suitable graphical representation. (ii) Write the equation of Verhulst-Pearl logistic growth curve.

(b) (i) Describe the logistic population growth curve with the help of a suitable graphical representation. (ii) Write the equation of Verhulst-Pearl logistic growth curve K

Write an equation for Verhulst-Pearl Logistic Growth Curve where: N = Population density at t, r = Intrinsic rate of natural increase. Draw a graph for a population whose population density has reached carrying capacity. Draw a growth curve where resources are non-limiting to growth of population. Which growth curve is considered more realistic and why? Explain.

(b) (i) Write an equation for Verhulst-Pearl Logistic Growth Curve where N = Population density at t, r = Intrinsic rate of natural increase. (ii) Draw a graph for a population whose population density has reached carrying capacity. (iii) Draw a growth curve where resources are non-limiting to growth of population. (iv) Which growth curve is considered more realistic and why? Explain.

In an ecosystem, different species occupy different levels and vertical distribution of species is found. This is called _________.

1. Stratification
2. Layering
3. Fragmentation
4. Population

Assertion (A): In terrestrial ecosystem much larger fraction of energy flows through grazing food chain. Reason (R): Grazing food chain may be connected to Detritus food chain at some levels.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation for Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation for Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Which of the following is not a component of detritus food chain?

1. Dead Leaves
2. Bacteria
3. Fungi
4. Zooplankton

Which of the following is not a functional unit of an ecosystem?

1. Energy flow
2. Decomposition
3. Stratification
4. Productivity

Every trophic level has a certain mass of living material at a particular time. What is it called?

1. Standing crop
2. Primary productivity
3. Standing state
4. Ecological efficiency

Assertion (A): Ecosystems require a constant supply of energy to synthesize the molecules they require. Reason (R): This is to counteract the universal tendency towards increasing disorderliness as per Second Law of Thermodynamics.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Which of the following is a secondary consumer ?

1. Grasshopper
2. Cow
3. Fish
4. Hawk

Match the items given in Column I with Column II and select the correct option. Column I: a. Earthworm b. Zooplankton c. Phytoplankton d. Inverted pyramid. Column II: i. Aquatic Ecosystem ii. Detritivore iii. Pyramid of Biomass in Sea iv. Primary Producer

1. a-i, b-ii, c-iii, d-iv
2. a-ii, b-iii, c-iv, d-i
3. a-ii, b-iv, c-i, d-iii
4. a-ii, b-i, c-iv, d-iii

Assertion (A) : Net Primary Productivity (NPP) is always less than Gross Primary Productivity (GPP). Reason (R) : A portion of Gross Primary Productivity (GPP) is used by plants for respiration.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): The pyramid of biomass in a pond aquatic ecosystem is always inverted. Reason (R): The biomass of consumers like fishes far exceeds that of the producers like phytoplanktons.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Assertion (A): Decomposition process is slower, if detritus is rich in lignin and cutin. Reason (R): Decomposition is largely an oxygen-requiring process.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

The biomass available in plants for consumption by herbivores and decomposers, is called:

1. Gross primary productivity
2. Net primary productivity
3. Standing crop
4. Secondary productivity

Which of the following ecosystem is most productive in terms of net primary productivity?

1. Desert
2. Tropical rainforests
3. Oceans
4. Estuaries

Cattle or goats are never seen browsing on the weed, Calotropis. Select the correct option for the reason.

1. The plant produces highly poisonous tannins
2. The plant produces quinine, which is bitter in taste
3. The plant produces the poisonous chemical, cardiac glycoside
4. The plant bears prickles

Which one of the following is not a characteristic feature of "humus" that is formed during decomposition of detritus?

1. amorphous, colloidal, dark coloured substance
2. amorphous, colloidal, light coloured substance
3. substance resistant to microbial action
4. colloidal substance

The rate of formation of new organic matter by consumers, and the biomass available for consumption of herbivores as well as decomposers are referred to as :

1. Gross primary productivity and Net primary productivity
2. Net primary productivity and Secondary productivity
3. Secondary productivity and Net primary productivity
4. Secondary productivity and Gross primary productivity

Read the four statements given below and select the option having two correct statements: (i) A lion eating a deer and a sparrow feeding on grains are ecologically similar in being consumers. (ii) Predator starfish Pisaster helps in maintaining species diversity of some invertebrates. (iii) Predators ultimately lead to extinction of prey species. (iv) Production of chemicals nicotine and strychnine by plants are metabolic disorders.

1. (i) and (iii)
2. (ii) and (iv)
3. (i) and (ii)
4. (iii) and (iv)

The organism that occupies more than one trophic level in a pond ecosystem is :

1. Fish
2. Frog
3. Zooplankton
4. Phytoplankton

The pyramid of biomass in sea is generally inverted because in sea :

1. Biomass of fishes exceeds that of phytoplankton
2. Number of phytoplanktons is more
3. Number of phytoplanktons is less
4. Large fishes feed on small fishes

Assertion (A): Some aquatic ecosystems have inverted biomass pyramids. Reason (R): More energy is required by the organisms occupying higher trophic levels.

1. Both (A) and (R) are true and (R) is the correct explanation of (A).
2. Both (A) and (R) are true and (R) is not the correct explanation of (A).
3. (A) is true, but (R) is false.
4. (A) is false, but (R) is true.

What is primary productivity of an ecosystem and how is it expressed? Explain the equation given below: NPP = GPP – R

(a) (i) Which organisms capture energy that sustains the entire living world? What is the source of this energy? (ii) How do ecosystems comply with the Second Law of Thermodynamics? OR (b) "Alien species are highly invasive and are a threat to indigenous species." Substantiate this statement with the help of any two examples.

Correctly depict (also indicate the trophic level) and describe the ecological pyramid of biomass in sea with 40 standing crop of phytoplankton supporting 90 standing crop of zooplankton which further supports 120 small fishes.

(b) Correctly depict (also indicate the trophic level) and describe the ecological pyramid of number with 32 birds dependent on 20 insects feeding on one banyan tree.

(a) Explain how the interaction between a fig tree and its tight one-to-one relationship with the pollinator species of wasp is one of the best examples of mutualism. OR (b) Correctly depict (also indicate the trophic level) and describe the ecological pyramid of number with 32 birds dependent on 20 insects feeding on one banyan tree.

Arrange the given important steps of decomposition in their correct order of occurrence in the breakdown of complex organic matter and explain the fourth step in the process. Catabolism, Leaching, Fragmentation, Mineralisation, Humification

How is the rate of decomposition affected by the nature of detritus and temperature ?

(a) Write the key characteristics of the humus formed during the decomposition cycle in a terrestrial ecosystem. OR (b) (i) Graphically represent the relationship between species richness and area on a log-log scale for bats and fishes. (ii) Write the equation for the relationship as on a logarithmic scale.

(a) List the important characteristics of humus formed during the decomposition cycle in a terrestrial ecosystem. OR (b) (i) Graphically represent the relationship between species richness and area on a log-log scale for bats and fishes. (ii) Write the equation for the relationship as on a logarithmic scale.

(a) Describe the important aspects of humus formation during the decomposition cycle in a terrestrial ecosystem. OR (b) (i) Graphically represent the relationship between species richness and area on a log-log scale for bats and fishes. (ii) Write the equation for the relationship on a logarithmic scale.

(a) Differentiate between grazing food chain and detritus food chain.

Ecological pyramids give important information about the ecological system, but do have some limitations. List any two limitations of ecological pyramids.

Plants capture only 2–10 percent of the photosynthetically active radiation of the Sun and this small amount of energy is able to sustain the entire living world. During this process, ecosystems are in consonance with the two laws of thermodynamics. Explain.

On August 22 in the year 2022, 3358 fires were detected in the Amazon rainforests. Write one short-term and one long-term effect of this event on the biotic and abiotic components of the environment.

(a) What is primary productivity? Why does it vary in different types of ecosystems? (b) Why is the assimilation of energy at the herbivore level called secondary productivity?

Enlist one advantage and two disadvantages of green revolution.

Name the type of food chains responsible for the flow of larger fraction of energy in an aquatic ecosystem and a terrestrial ecosystem, respectively. Mention any two differences between the two food chains.

(a) How is the grazing food chain different from the detritus food chain? (b) "The detritus food chain may be connected to the grazing food chain at some levels in an ecosystem." Give an example in support of the statement.

(a) Construct a pyramid of biomass in sea with phytoplankton and fishes. Explain giving reasons about the characteristic of the constructed pyramid. (b) In which condition will the pyramid remain always upright ?

(a) State what is primary productivity and mention its units. (b) Some ecologists observed that primary productivity of a place in Rajasthan was low as compared to a particular place in Kerala. Explain why.

Predation is referred to as a detrimental interaction. Explain any three positive roles, supported by an example each, that a predator plays in an ecosystem.

Describe the mutualistic relationship that exists between the Mediterranean orchid Ophrys and a bee species.

Explain any three roles of predation in an ecosystem with the help of suitable examples.

(a) (i) What is meant by 'Stable Community'? (ii) What are its characteristics? (iii) Name the ecologist who carried out experiments on the above to provide a tentative answer and also write his findings. OR (b) (i) Write the role of detritivores and give one example also. (ii) Explain 'Catabolism' and 'Humification' – steps of decomposition. (iii) Compare the grazing food chain and detritus food chain in the aspect of their: (I) origin, and (II) energy status.

Select the mismatched pair:

1. Mega diversity countries in the world – 12
2. Genetically different strains of rice in India – Less than 1000
3. Robert Mays estimation on global species diversity – 7 million species worldwide
4. Zoological parks – Ex-situ conservation

Which of the following sacred groves is found in Meghalaya?

1. Jaintia hills
2. Bastar
3. Chanda
4. Sarguja

Exploration of molecular, genetic and species level diversity for gaining products of economic importance is called

1. Exploitation
2. Bio-prospecting
3. Bio-patenting
4. Bio-piracy

Select the correct option :

1. Tropics between 23.5 ° N – 23.5° S –– Higher biodiversity than temperate areas
2. Columbia –– 105 bird species
3. New York –– 1400 bird species
4. India –– 2000 bird species

What could be the reason of extinction of Abingdon Tortoise from Galapagos Islands ?

1. Intraspecific Competition
2. Predation
3. Parasitism
4. Interspecific Competition

Assertion (A) : IUCN Red List helps in identifying and protecting endangered species worldwide. Reason (R) : The list includes the species facing risk of extinction.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation for Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not correct explanation for Assertion (A).
3. Assertion (A) is true, Reason (R) is false.
4. Assertion (A) is false, Reason (R) is true.

If A = species richness and B = Endemism then biodiversity hotspots have

1. low degree of A and low degree of B.
2. low degree of A and high degree of B.
3. high degree of A and low degree of B.
4. high degree of A and high degree of B.

Current percentage of tropical rainforests covering the Earth's land surface is

1. 14%
2. 6%
3. 8%
4. 15%

Which of the following fish led to the extinction of an ecologically unique assemblage of more than 200 species of cichlid fish in Lake Victoria of East Africa?

1. Catla Catla
2. Dogfish
3. Nile Perch
4. African Catfish

According to IUCN, some of the extinctions include: (i) Dodo (ii) Indian gazelle (iii) Thylacine (iv) Steller's Sea Cow

1. (i), (ii), (iii) and (iv)
2. (ii) and (iv)
3. (i), (iii) and (iv)
4. (iii) and (iv)

Assertion (A): Communities that comprise of more species tend to be more stable. Reason (R): A higher number of species results in less year to year variation in total biomass.

1. Both (A) and (R) are true and (R) is the correct explanation of (A).
2. Both (A) and (R) are true, but (R) is not the correct explanation of (A).
3. (A) is true, but (R) is false.
4. (A) is false, but (R) is true.

Assertion (A): "Biodiversity hotspots" are the regions which possess high levels of species richness, high degree of endemism. Reason (R): Total number of biodiversity hotspots in the world is 22 with two of these hotspots found in India.

1. Both (A) and (R) are true and (R) is the correct explanation of (A).
2. Both (A) and (R) are true, but (R) is not the correct explanation of (A).
3. (A) is true, but (R) is false.
4. (A) is false, but (R) is true.

Assertion (A) : Loss of biodiversity can occur due to overexploitation of resources. Reason (R) : Introduction of Clarias gariepinus in Indian rivers has led to a decline in native Indian fishes.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A)
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A)
3. Assertion (A) is true, but Reason (R) is false
4. Assertion (A) is false, but Reason (R) is true

Assertion (A) : Cattle and goats are never seen browsing on Calotropis growing in abandoned fields. Reason (R) : Cattle and goats avoid grazing on Calotropis because of the offensive smell of its flowers.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

Human settlement often leads to habitat loss which leads to fragmentation, forming smaller patches of habitats. Select the statements that describe how a small patch differs from a large patch of the same habitat. (i) Invasive species will never be seen here. (ii) Population of large animals decreases. (iii) Biodiversity decreases. (iv) Competition from surrounding habitats increases.

1. (ii), (iii) and (iv) only
2. (ii) and (iv) only
3. (i) and (iii) only
4. (i), (ii) and (iii) only

Which one among the following regions is not a hotspot of biodiversity?

1. The Indo-Burma Region
2. Jaintia Hills in Meghalaya
3. The Western Ghats and Sri Lanka
4. The Himalayas

Assertion (A): Biologists are sure about how many prokaryotic species are living now. Reason (R): The conventional taxonomic methods are not suitable for identifying microbial species.

1. Both Assertion (A) and Reason (R) are true and Reason (R) is the correct explanation of the Assertion (A).
2. Both Assertion (A) and Reason (R) are true, but Reason (R) is not the correct explanation of the Assertion (A).
3. Assertion (A) is true, but Reason (R) is false.
4. Assertion (A) is false, but Reason (R) is true.

(b) In an ecosystem there was loss of biodiversity due to some project in that area. (i) How will biodiversity be affected? (2 points) (1 mark) (ii) List two major causes of loss of biodiversity. (1 mark)

(b) What factors contribute to the Amazonian rain forests in South America being the most biodiverse regions on Earth ?

(a) Biodiversity must be conserved as it plays an important role in many ecosystem services that nature provides. Explain any two ecosystem services.

(a) Biodiversity must be conserved as it plays an important role in many ecosystem services that nature provides. Explain any two ecosystem services. OR (b) (i) State, what does 'standing crop' of a trophic level represent. (ii) List any two ways of measuring the standing crop of a trophic level.

How is the interaction between Ophrys and its specific bee pollinator one of the best examples of co-evolution ? Explain.

A specific plant species was introduced into Australia in 1920 and later it became invasive spreading over millions of hectares of rangeland. (a) Name the plant that was introduced into Australia and mention the reason for its uncontrollable growth. (b) State how its spread was eventually brought under control.

(a) Biodiversity hotspots cover less than 2% of Earth's land area. Strict protection of these areas can reduce the rate of ongoing extinctions. Explain. (b) Name any two hotspots in India.

India is the seventh largest country in the world in terms of total land area including land and water. Write the value of the land area of our country (in terms of percentage) of the world. Mention then, what makes India one of the 12 mega diversity countries of the world.

(a) Mention the main objective of the Ramsar Convention. (b) Name any two sites in India that are important in the Ramsar Convention.

Illustrate with the help of an example how introduction of an alien species turns invasive and causes decline of an indigenous species.

There are many animals, which have become extinct in the wild, but continue to be maintained in zoological parks. Answer the questions that follow: (a) What type of bio-diversity conservation is observed in this case? (b) Explain any other two ways which help in this type of conservation. (c) Besides zoological parks, mention one place that serves this purpose.

Explain the level of biodiversity at genetic, species and ecological levels with the help of one example each.

The survival of rare species in Mudumalai Tiger Reserve (MTR) was found to be a small, beautiful flower, Lantana camara, a tropical American shrub. A Lantana weed eradication drive helped to restore the dying MTR thereby also reducing human-wildlife conflicts. MTR is home to 25 species of grasses and legumes. (a) Explain how did the removal of Lantana help in restoring the dying Mudumalai Tiger Reserve. (b) Why is the invasion of Lantana camara a cause of concern in MTR.

In a case study of species diversity and restoration of survival in Mudumalai Tiger Reserve (MTR) was found to be a small, beautiful flower, Lantana camara, a tropical American shrub, that Lantana weed eradication drive helped to restore the dying MTR thereby also reducing human-wildlife conflicts. MTR is home to 25 species of grasses and legumes. (a) Explain how did the removal of Lantana help in restoring the dying Mudumalai Tiger Reserve. (b) Why is the invasion of Lantana camara a cause of concern in MTR.

In Mudumalai Tiger Reserve (MTR), a survival threat to tiger was posed by Lantana camara, a tropical American shrub. A Lantana weed eradication drive helped to restore the dying MTR thereby also reducing human-wildlife conflicts. MTR is home to 25 species of grasses and legumes. (a) Explain how did the removal of Lantana help in restoring the dying Mudumalai Tiger Reserve. (b) Why is the invasion of Lantana camara a cause of concern in MTR.

Explain how the loss of habitat and fragmentation drives plants and animals to extinction with the help of an example of habitat loss in the Tropical Rain Forest. Also write the effect of fragmentation of a habitat on the population decline.

(a) Alien species are highly invasive and are a threat to indigenous species. Substantiate this statement with the help of any two examples. (b) State any two criteria for determining biodiversity hotspots.

Tropical regions harbour more species than the temperate regions. How have biologists tried to explain this in their own ways? Explain.

The world is facing accelerated rates of species extinction largely due to human activities. Explain any three human activities responsible for accelerated rates of species extinction.